Write the following ratio in simplest form: 32 min : 36 min (1 point) a. 8 : 9 b. 8 : 36 c. 32 : 9 d. 128 : 144

Answers

Answer 1

The simplest form of the given ratio 32 min : 36 min is equal to  

option a. 8 : 9.

Ratio  is equal to

32 min : 36 min

Factors of 32 are = 1, 2, 4, 8, 16, 32

Factors of 36 are = 1, 2, 3, 4, 6, 9, 12, 18, 36

Greatest common factor of 32 and 36 is equal to 4

Simplest form of the given ratio is equal to

32 min : 36 min

= ( 8 × 4 ) min : ( 9 × 4 ) min

'4' get cancelled with other we get,

= 8 min : 9 min

Therefore, the simplest form of the given ratio by taking out common factors is equal to option a. 8 : 9 .

Learn more about ratio here

brainly.com/question/13419413

#SPJ4


Related Questions

Which expression can be used to find the
surface area of the triangular prism?
4-2+3.2+5.2
2
2.3.4+4-2+3·2+5-2
1/2-3-4) -
2
+4-2+3.2+5.2
3.4+4-2+3-2+5-2
2
4 ft
4 ft
3 ft
3 ft
5 ft
2 ft
5 ft
2 ft

Answers

The expression used to find the surface area of the rectangular prism is given as follows:

S = 2 x (1/2 x 3 x 4) + 4 x 2 + 3 x 2 + 5 x 2.

How to obtain the surface area?


The prism is composed as follows:

Two right triangles of 4 ft and 3 ft.One rectangle of dimensions 2 ft and 5 ft.One rectangle of dimensions 3 ft and 2 ft.One rectangle of dimensions 3 ft and 4 ft.

The area of each component is given as follows:

Two right triangles of 4 ft and 3 ft: 2 x 0.5 x 4 x 3.One rectangle of dimensions 2 ft and 5 ft: 2 x 5One rectangle of dimensions 3 ft and 2 ft: 3 x 2.One rectangle of dimensions 3 ft and 4 ft: 3 x 4.

The surface area is given by the addition of all these areas.

More can be learned about surface area at https://brainly.com/question/30406970

#SPJ1

pls help i don’t understand how to graph

Answers

Answer:

Slope: [tex]\bf \boxed{-\dfrac{1}{3}}[/tex]

y-intercept: [tex]\boxed{-1}[/tex]

Equation: [tex]\boxed{\bf{y=-\dfrac{1}{3}x - 1}}[/tex]

The two boxes at the bottom are asking you to repeat the above information:

the slope is [tex]\bf \boxed{-\dfrac{1}{3}}[/tex]   the y-intercept is [tex]\boxed{-1}[/tex]

Step-by-step explanation:

Actually, you don't have to graph the equation since the graph is already provided

You have to answer the questions based on the provided graph

To find slope

1. Take any two well=defined points on the graph:

We can see that point (0, -1) which has x value at 0 and y-value 1 unit down is a distinguishable point. Let's call this point P1Another point is (3, -2). Let's call this point P2

2. Find the difference in y-values between P2 - P1. This called rise

rise = P2 v-value - P1 y-value = -2 - (-1) = -2 + 1 =  - 1


3. Find the corresponding difference in x-values: P2 - P. This is called run

run = P2 x-value - P1 x-value = 3 - 0 = 3


4. The slope is computed as rise/run = - 1/3

To find y-intercept

Just note where the line crosses the y-axis and the y-value corresponding to that would be the y-intercept

This is also the y-value at which x = 0

Looking at the graph we see that the line crosses(intercepts) the y-axis at y = - 1
So y-intercept = - 1

To write the equation

The equation of the line is
y = mx + b

where

m = slope

b = y-intercept

So the equation of this particular line is

[tex]\bf{-\dfrac{1}{3}x - 1}[/tex]



3x + 6 = 8x - 11, what is the value of 10x + 2

Answers

Answer:

36

Step-by-step explanation:

3x+6= 8x-11

3x-8x= -11-6

-5x= -17x

x= 3  2/5

10x+2= 10(3  2/5)+2

         = 34+2

         = 36

this is kinda complex ngl could any high schoolers help me? this is the problem.

Solve for
a
aa.
Give an exact answer.
3
+
0.5
(
4
a
+
8
)
=
9

2
a
3+0.5(4a+8)=9−2a. A= ?

Answers

Answer:

  a = 1/2

Step-by-step explanation:

You want the solution to 3 +0.5(4a +8) = 9 −2a.

Solution

It usually works well to start by simplifying the equation. That is, you eliminate parentheses, combine like terms.

  3 +0.5(4a) +0.5(8) = 9 -2a

  3 + 2a +4 = 9 -2a

  7 +4a = 9 . . . . . . . . . add 2a

  4a = 2 . . . . . . . . . subtract 7

  a = 0.5 . . . . . . divide by 4

The value of a is 1/2.

__

Additional comment

The attached calculator output shows this value of 'a' satisfies the equation.

Estelle has $300 in a savings account. The interest rate is 5% per year and is not compounded. How much interest will she earn in 1 year?

Answers

$15 is the interest on the amount saved in a year

Calculating the simple interest on a sum of money

The formula for calculating simple interest is expressed according to the equation below:

I = PRT

where:

P is the principal = $300

R is the rate = 5% = 0.05

T is the time = 1 year

Substitute to have:

I = 300 * 0.05 * 1

I = $15

Hence the interest that she will earn in a year is $15

Learn more on interest here: https://brainly.com/question/25793394

#SPJ1

The names of the months of the year are cut from a calendar and put into a bag. A month with more than 5 letters in its name is drawn. What is the probability of the complement of the event? Express your answer as a fraction in simplest form.

Answers

Answer:

Step-by-step explanation:

There are 12 months in a year, and 7 of them have more than 5 letters in their names (July, August, September, October, November, December, and January).

The complement of the event is drawing a month with 5 or fewer letters in its name. There are 5 months with 5 letters in their names (May, March, April, June, and August), and 2 months with 4 letters in their names (July and June). Therefore, there are 7 months with 5 or fewer letters in their names.

The probability of drawing a month with 5 or fewer letters in its name is 7/12. The probability of the complement of the event (drawing a month with more than 5 letters in its name) is 1 - 7/12 = 5/12.

Therefore, the probability of the complement of the event is 5/12.

If yall ain't gotta show work just put 5/12 that's the answer the person with the long paragraph

Petrolyn motor oil is a combination of natural oil and synthetic oil. It contains 4 liters of natural oil for every 5 liters of synthetic oil. In order to make 855 liters
of Petrolyn oil, how many liters of natural oil are needed?

Answers

Using the concept of proportions and ratios, 684L of natural oil is required to produce 855L of Petrolyn oil.

What is Proportions

Proportions are mathematical statements that express the equality of two ratios. A ratio is a comparison of two values, often written as a fraction. For example, if you have 5 apples and 2 bananas, the ratio of apples to bananas can be written as 5/2. A proportion is an equation that sets two ratios equal to each other, such as:

a/b = c/d

In this problem, we need to find the ratio or simply equate and calculate how many liters of natural oil are needed

4L of natural oil = 5L of synthetic oil

xL of natural oil = 855L

cross multiply both sides and solve for x

x = (855 * 4) / 5

x = 684L

Learn more on proportions here;

https://brainly.com/question/2328454

#SPJ1

What is the equation of the line with slope -5 and y-intercept 6 in slope-intercept form?

Answers

Answer:y=-5x+6

Step-by-step explanation:

Reeta has spent 2/7 of her salary on car repair work. She has 15,000 rupees left with her. what is her salary?

Answers

Answer 15489 Rupees

Step-by-step explanation:

Total parts= 7+2=9 parts

total salary= 9x
taken salary for car repair= 2x/7
remaining salary= 15000 rupees

9x-2x/7= 15000
(63x-2x)/7=15000
61x/7=15000

61x=105000
x= 105000/61
x= 1721(approx)

Total salary= 9x
                   = 9*1721
                   =15489 rupees


Mark as brainliest ;)

(x + 3)^2 Write your answer as a list of values separated by commas.

Answers

The values are written in commas as x², 6x  and 9

How to determine the values

It is important to note that algebraic expressions are expressions that are made of terms, variables, coefficients, factors and constants.

From the information given, we have the quadratic expression as:

(x + 3)^2

Now, take the following steps to determine the values

(x + 3)(x +3)

expand the bracket, we get;

x² + 3x + 3x + 9

Now, collect the like terms and add the values

x² + 6x + 9

Hence, the value is x² + 6x + 9

Learn about quadratic equations at: https://brainly.com/question/1214333

#SPJ1

A cylinder is full at 471 cubic centimeters and has a radius of 5 centimeters. What is the height of the cylinder?

Use 3.14 for pi.

Dont forget to track your thinking on paper. You will need this answer for the next problem.

Question 7 options:

A 94.2 cm
B 18.84 cm
C 30 cm
D 6 cm

Answers

The height of the cylinder having a volume of 471 cubic centimetres will be 6 cm. The correct option is D.


What is the volume?

The volume of the cylinder is defined as the three-dimensional space occupied by the cylinder.

We can use the formula for the volume of a cylinder, which is given:

V = πr²h

Where V is the volume, r is the radius, and h is the height of the cylinder.

We are given that the cylinder is full at 471 cubic centimetres and that the radius is 5 centimetres. Therefore, we can plug in these values into the formula and solve for h:

471 = π(5²)h

471 = 25πh

h = 471 / (25π)

h ≈ 6 centimeters

Therefore, the height of the cylinder is approximately 6 centimetres.

To know more about volume follow

https://brainly.com/question/23935577

#SPJ1


Sean painted 1/3 of a fence. Sandra painted 1/4 of the fence. How much
of the fence remains to be painted?


Answers

Answer:7/12

Step-by-step explanation:

1/3 = 4/12

1/4=3/12

3/12+4/12 = 7/12

7/12 is the answer

y=x-6 and y=-x-2 graph the system then right a solution if there is one

Answers

Answer: To graph the system of linear equations, you can plot the two lines on the same coordinate plane and look for the point where they intersect. If they intersect, that point represents the solution to the system.

The equation y = x - 6 can be written in slope-intercept form, y = mx + b, where m = 1 and b = -6. The equation of the line will be y = x - 6.

The equation y = -x - 2 can be written in slope-intercept form, y = mx + b, where m = -1 and b = -2. The equation of the line will be y = -x - 2.

Plotting these two lines on the same coordinate plane, we can see that they intersect at the point (2, -4). This means that there is one solution to the system of equations: (2, -4).

Step-by-step explanation:

Need help ASAP please!!!!!

Answers

Answer:

122

Step-by-step explanation:

the question is asking for the area of the whole shape

however, it's split into a trapezoid and rectangle, so all you have to do is find the area of the respective shapes and then add them

the formula for area of a rectangle is [tex]A = L(W)[/tex]

if you substitue, A = 15(6)

so the area of the rectangle is 90

then, you have the trapezoid

area of a trapezoid = [tex]\frac{1}{2} (h)(b_{1} +b_{2})[/tex]

you might assume that you don't have the second base, but it's in the rectangle - 6

A = 1/2(4)(6+10)

A=32

90+32 = 122

Which expression can be used to find the value of the expression shown below?

1,284 ÷ 4

A (1,200 ÷ 4) × (84 ÷ 4)
B (1,200 ÷ 4) ÷ (84 ÷ 4)
C (1,200 ÷ 4) + (84 ÷ 4)
D (1,200 ÷ 4) - (84 ÷ 4)

Answers

C: 1,284➗4 = 321
1,200➗4 =300+84➗4 =321

HURRY PLEASE LIKE TODAY

What could you multiply the second (purple) equation by to make the y-values additive inverses?

Answers

-2 is to be multiplied in the second equation to make the y-values additive inverses.

What are additive inverses?

Additive inverse simply means changing the sign of the number and adding it to the original number to get an answer equal to 0.

Given are two equations,

3x-4y = -5.....(i)

5x-2y = -6.....(ii)

We need to find the additive inverse of y variable,

The coefficients of y variables in the both equations are ;-

-4 and -2

The additive inverse of -4 is 4,

If we multiply -2 by -2 it becomes 4,

Hence, -2 is to be multiplied in the second equation to make the y-values additive inverses.

Learn more about additive inverse, click;

https://brainly.com/question/13715269

#SPJ1

Justifying a Claim Based on a Confidence Interval for a Population Proportion

Based on the simulation, what proportion of the 95 percent confidence intervals capture the population proportion of 0.3? Explain how you determined your answer.​

Answers

Based on the simulation, we can say that, 95% of proportion of the 95 percent confidence intervals capture the population proportion of 0.3.

What is Confidence Interval?

Confidence interval in statistics is defined as the certain range of values that you estimate for the unknown parameter lies within.

This means that, if you do your experiment more than once and do resampling, then this is the percentage that the parameters falls within a range.

If we say that the confidence interval is A% for a certain parameter like proportion, mean, standard deviation, etc. to be fall within a range of x and y, then this can be interpreted as that we are A% confident that the parameters fall within x and y.

In other words, A% of the intervals capture the parameters.

Therefore, here, we can say that, 95% of the 95% confidence intervals will capture the population proportion of 0.3.

Hence 95% of proportion of the 95 percent confidence intervals capture the given proportion.

Learn more about Confidence Interval here :

https://brainly.com/question/24131141

#SPJ9

A toy is in the form of a cone mounted on a hemisphere of the same diameter. the radius of the base is 5cm and height of the cone is 12cm

Answers

Answer:

Step-by-step explanation:

Given the radius of the base of the cone is 5 cm and the height of the cone is 12 cm, we can find the volume of the toy as follows:

Volume of the cone:

The volume of a cone can be found using the formula: V = (π * r^2 * h) / 3, where r is the radius and h is the height of the cone.

Plugging in the values, we get:

V = (π * 5^2 * 12) / 3 = 100π cm^3

Volume of the hemisphere:

The volume of a hemisphere can be found using the formula: V = (4/3) * π * r^3, where r is the radius of the hemisphere.

Plugging in the values, we get:

V = (4/3) * π * 5^3 = (4/3) * π * 125 = 500π / 3 cm^3

Total volume of the toy:

The total volume of the toy is equal to the sum of the volume of the cone and the volume of the hemisphere:

V = 100π + 500π / 3 = (100 + 500 / 3) * π = 600π / 3 cm^3

So, the total volume of the toy is 600π / 3 cubic centimeters.

Rhea wants to purchase a new home house. The house on main street requires a $10,000 down payment and will be a $900 a month on the loan. the other house she likes on Empire Road who has a $4000 down payment and is $1050 per month. Which house has a greater rate of change and what is it? Which house had a greater initial value and what is it?

Answers

Answer:

Step-by-step explanation:

First, we'll write the cost equations for each house, using the number of months since the initial purchase as the independent variable X:

For the house on Main Street:

Cost = 900X + 10,000

For the house on Empire Road:

Cost = 1050X + 4000

Next, we'll find the rate of change for each house by finding the slope of the respective cost equation:

The slope of the cost equation for the house on Main Street is 900. This means that for every month that passes, the cost of the house will increase by $900.

The slope of the cost equation for the house on Empire Road is 1050. This means that for every month that passes, the cost of the house will increase by $1050.

Now that we have found the rate of change for each house, we can compare them to determine which house has the greater rate of change:

Since the slope of the cost equation for the house on Empire Road is greater than the slope of the cost equation for the house on Main Street (1050 > 900), the house on Empire Road has a greater rate of change.

Finally, we can compare the initial values of each house by comparing the y-intercepts of the respective cost equations:

The y-intercept of the cost equation for the house on Main Street is 10,000, which means that the initial cost of the house is $10,000.

The y-intercept of the cost equation for the house on Empire Road is 4000, which means that the initial cost of the house is $4,000.

Since the y-intercept of the cost equation for the house on Main Street is greater than the y-intercept of the cost equation for the house on Empire Road (10,000 > 4,000), the house on Main Street has a greater initial value.

how to find the exact value of a trig function

Answers

The exact value of a trig function can be found by using the unit circle, the trigonometric identities, tables or a calculator.

How to find the exact value of a trig function?

To find the exact value of a trigonometric function, there are several methods you can use. Below are a few:

1. Using the Unit Circle: The unit circle is a circle with radius 1 centered at the origin in the coordinate plane. The angles in the unit circle are measured in radians and the coordinates of points on the circle can be used to find the exact values of trigonometric functions. For example, given an angle θ in the unit circle, the x-coordinate of the point on the circle corresponding to θ is cos(θ) and the y-coordinate is sin(θ).

2. Using the Trigonometric Identities: There are several trigonometric identities that relate the values of the six trigonometric functions to one another. These identities can be used to find the exact value of a trigonometric function for certain angles. For example, the Pythagorean identity states that for any angle θ, sin²(θ) + cos²(θ) = 1.

3. Using Tables or a Calculator: Trigonometric tables or a scientific calculator can be used to find the exact values of trigonometric functions for certain angles. The values are often given in degrees, so it is important to convert the angle to radians if necessary.

Learn more about trigonometry on:

https://brainly.com/question/29529966

#SPJ1

[tex]456.232 ÷ 4[/tex]pls help me

Answers

Answer:

Step-by-step explanation:

$\frac{456.232}{4}$

An art teacher enlarged the area of a copy of a painting by 49%. Let d represent the
area of the original painting. The expression d+ 0.49d is one way to represent the area of the new painting. Write two additional expressions that will give the area of the new
painting.

Answers

The required two other expression are d + 49d/100 and 149d/100.

What is percentage?

In essence, percentages are fractions with a 100 as the denominator. We place the percent symbol (%) next to the number to indicate that the number is a percentage. For instance, you would have received a 75% grade if you answered 75 out of 100 questions correctly on a test (75/100).

According to question:

We have;

An art teacher enlarged the area of a copy of a painting by 49%. and d represent the area of the original painting.

Given expression is d+ 0.49d

New expressions are

1) d+ 0.49d

= d + 49d/100

2) d+ 0.49d

= d + 49d/100

= 149d/100

Thus, required two other expression are d + 49d/100 and 149d/100.

To know more about Percentage visit:

brainly.com/question/16797504

#SPJ1

Drag and drop numbers into the boxes to complete the expanded form of 916.408

Answers

The expanded form of 916.408 can be written as:

(9 x 100) + (1 x 10) + (6 x 1) + (4 x 0.1) + (8 x 0.01)

What is expanded form?

Expanded form is a way of writing a number that shows the place value of each digit in the number. In expanded form, a number is expressed as the sum of individual terms, each representing a digit in the number multiplied by its place value.

For example, the number 356 can be written in expanded form as:

3 x 100 + 5 x 10 + 6 x 1

Expanded form can be used to better understand the structure of numbers and how place value works.

So, the numbers should be placed as follows:

(9 x 1,000) + (1 x 100) + (6 x 10) + (4 x 1) + (8 x 0.1)

Therefore, the correct order is:

1000, 100, 10, 1, 0.1

To know more about expanded form check:

https://brainly.com/question/17837892

#SPJ1

What is 5.3 as a fraction?

Answers

Answer:

Step-by-step explanation:53/10

1,530÷34 how to do it

Answers

Answer:It is 45

Step-by-step explanation:Take 1,530 and divid it by 34 using a calculator.

The square footage and monthly rental of 10 rental of 10 similar one-bedroom apartments yield the linear regression y=0.775x+950.25, where x represents the square footage of the apartment and y represents the monthly rental price. Grace can afford $1,500 per month rent. Using the equation, what size apartment should she expect to be able to rent for that price? Explain work in a sentence. :)

Answers

Answer:

Grace can expect to rent an apartment with a size of approximately 710.32 square feet for $1,500 per month based on the given linear regression equation.

Step-by-step explanation:

The given linear regression equation is y=0.775x+950.25, where x represents the square footage of the apartment and y represents the monthly rental price. To find the size of the apartment Grace can expect to rent for $1,500 per month, we can substitute y with 1,500 in the equation and solve for x:

1,500 = 0.775x + 950.25

0.775x = 1,500 - 950.25

0.775x = 549.75

x = 710.32

Therefore, Grace can expect to rent an apartment with a size of approximately 710.32 square feet for $1,500 per month based on the given linear regression equation.

Estimate the following difference by replacing each fraction with 0, 12
, or 1.

7/8−6/11

Answers

If we substitute so every tiny proportion with 0, 1, or 12, the approximate distinction among 7/8 and 6/11 is then equal to 0.

What is a difference example?

the end result of subtracting two numbers. the difference between two numbers. Example: Subtract five to get the difference between eight and three.

We can substitute each percentage with either a 0, 1, or 12 to calculate the difference between 7/8 and 6/11.

We can round up to one because we know that 7/8 is larger than 1/2 but much less over 1.

For 6/11, we can round up to 1 since we know it is larger than 1/2 but a little less than 1.

As a result, we can calculate the difference as follows:

7/8 - 6/11

= 1 - 1

= 0

To know more about Difference visit:

https://brainly.com/question/2331449

#SPJ1

What is a monomial example?

Answers

A monomial is an algebraic expression that consists of a single term. A monomial can contain constants and/or variables, which are multiplied together.

The expression 3x²y is a monomial. It contains the constant 3, the variable x squared, and the variable y. The variables can be raised to an exponent, as in this example; however, the exponent must be a whole number.A monomial can also contain coefficients, which are the numbers that are multiplied with a variable. In the example above, the coefficient is 3. If there is no coefficient stated, then the coefficient is assumed to be 1. Therefore, the expression x²y is also a monomial, with the coefficient being 1.Additionally, a monomial can contain a product of numbers and variables, such as the expression 2xyz. This is also considered a single term, since all of the numbers and variables are multiplied together.

Monomials can be used to calculate polynomials, which are algebraic expressions consisting of multiple terms. By adding, subtracting, and multiplying monomials together, you can create a polynomial. For example, the expression (3x²y) + (2xyz) is a polynomial, since it consists of two terms. The first term is the monomial 3x²y, and the second term is the monomial 2xyz.

Learn more about monomial here:

https://brainly.com/question/9183135

#SPJ4

PLEASE HELP ME!! I NEED THIS DONE FAST.
What is the common ratio of the following geometric sequence? 6, 4, 8/3, 16/9,...
a. r=2
b. r=2/3
c. r=3/2
d. r=-2

Answers

the answer to your question is c. r=3/2

Answer:

b

Step-by-step explanation:

T2÷T1=r and T3÷T2=r and T4÷T3=r

6(2x²-5) = [?]
x = -3

Answers

Answer:

Below

Step-by-step explanation:

Put ' - 3' into the equation where 'x' is and compute

6 ( 2(-3)^2 -5) =

6 ( 2*9   -5)

6 ( 18-5)

6(13) = 78

Other Questions
artists may weld, glue, bolt, screw, nail, and wire individual pieces together to create which type of sculpture? help please see photo why is cell division important for multicellular organisms In the diagram, segment AD bisects angle BAC.Given the following segment lengths, find the value of x.Round to the nearest tenth.AB = 23AC = 18 FILL IN THE BLANK. our goal as a nation and as a society must be to free ourselves completely of the __ of racial prejudices Though dark and light phenotypes existed among the moth populations, an albino moth was recently discovered. Complete the data below in order to better understand how this may DNA = ATCG happen. Complementary rules MRNA-UAGS Dark moth - Dominant allele: DNA: TACCGTCGCATACACTGGGGTCAGGACGAGTCGCATCCAGACGGGTCGTCGGACATGATC mRNA: AAS: Light moth Recessive allele: DNA: mRNA: AAS: Albino moth DNA: mRNA: AAS: - TACCGTCGCATACACTGGGGTTAGGACGAGTCGCATCCAGACGGGTCGTCGGACATGATC Unknown allele: TACCGTCGCATACACTGGGGTCAGGACGAGATCGCATCCAGACGGGTCGTCGGACATGATC When responding below, be sure to use the precise terms for the mutations when appropriate. Write a claim to answer this question: What you think occurred to produce the dark and light phenotypes? Provide specific evidence from the mRNA-amino acid sequences for this claim: Propose a hypothesis as to what occurred to produce an albino moth: find the measure of CDE,BC,AB, and CAB. What do you think about Morries decision when it comes to his epitaph? (Claim, Evidence, Reasoning) What was the effect of the Second Morrill Land Grant Act of 1890?Colleges and universities for Black students were created.Rural areas received their first universities.The first university for women was founded.It founded "normal schools" for the training of teachers. Can you replace the glass plate in a microwave? in tableau, measures are automatically aggregated to the granularity of the view, and the granularity, or number of marks, is set by ____ Provide a counterexample to the following statement: The number n is an even integer if an only if 3n + 2 is an even integer. Maximize Z = 7X1 + 5X2Subject to X1 + 2X2 6 4X1 + 3X2 12 X1, X2 0 I am having trouble in finding the path for hopscotch. I do not quite understand what I have to do? A generic element, a, is composed of two isotopes, 208a and 204a. 208a has a natural abundance of 55% and an isotopic mass of 207. 98 amu, and 204a has a nautral abundance of 45% and an isotopic mass of 203. 97 amu. What is the average atomic mass of this element?. A party that wants the Supreme Court to review a lower court ruling musta. present a non obstante veredicto.b. file a petition for a writ of certiorari.c. file a petition for a voir dire.d. present a motion to dismiss one of the basic frameworks used to describe how environments affect organizations is 1. What types of cells contain chloroplasts?2. What is the energy autotrophs use to make their own food?3.The food making process is called: ____________4.What are the raw materials for photosynthesis? 5.What simple sugar is produced? 6.What gas is used? ____________ What gas is released? ____________7.Where are most photosynthetic cells in plants found?8. About how many chloroplasts can be found in photosynthetic cells?9. How many membranes surround a chloroplast?10. The outer membrane is:____________11. The individual sacs formed by the inner membrane are called ___________ and are arranged in __________ like pancakes.12. What pigment is found inside a thylakoid? ____________ What color will it be in real cells?13. Other pigments that trap sunlight are called a____________ pigments. What colors are these pigments?____________________________________14. Stacks of thylakoids are called G____________(plural) or Granum (singular).15. Stacks or grana are connected to each other by____________. what surface groove separates the right and left ventricles? In a single nucleotide, the phosphate group is attached to the 5' carbon of the sugar unitTrue or false?