why is the late Cambrian thought of as the period of the greatest evolutionary change in life forms on earth's history?

Answers

Answer 1

Answer:

The Cambrian Period marks an important point in the history of life on Earth; it is the time when most of the major groups of animals first appear in the fossil record. This event is sometimes called the "Cambrian Explosion," because of the relatively short time over which this diversity of forms appears.


Related Questions

Plzz help
Determine the proper number of chromosomes that would be found in a human cell at each stage of the cell cycle.

Answers

Answer:  The genetic material of the cell is duplicated during S phase of interphase just as it was with mitosis resulting in 46 chromosomes and 92 chromatids during Prophase I and Metaphase I. However, these chromosomes are not arranged in the same way as they were during mitosis.

Explanation:

How does natural selection lead to the evolution of a species?

Answers

Answer:

One of these is natural selection, which is a process that increases the frequency of advantageous gene variants, called alleles, in a population. Natural selection can result in organisms that are more likely to survive and reproduce and may eventually lead to speciation.

Explanation:

When a species evolves, it can get more repellent and tougher to what kills them off. For exp, if a animal can’t survive due to a carried disease, it will eventually evolve to be stronger against it.

Type a paragraph describing how the circulatory and respiratory systems work together to deliver oxygen to the body’s tissues and remove carbon dioxide.
i. Include the names of structures and other components that play a role in gas
exchange.
ii. Explain how the interactions between the circulatory and respiratory systems
contribute to maintaining homeostasis in the body.
b) Type a second paragraph comparing the accuracy of your model to actual organ systems and
their functions.
i. Consider how a model is different from an actual human body.
ii. Describe the limitations of a model

Answers

Answer:

The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in and out of the lungs through the trachea, bronchi, and bronchioles. Blood moves in and out of the lungs through the pulmonary arteries and veins that connect to the heart.

The circulatory and respiratory system work together to provide oxygen and remove carbondioxide gas.

How circulatory and respiratory system work together?

The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in to bring oxygen and out of the lungs to remove carbondioxde gas from the body. Blood moves into the lungs to bring carbondioxide gas and to load oxygen with the help of pumping of heart.

So we can conclude that circulatory and respiratory system work together to provide oxygen and remove carbondioxide gas.

Learn more about system here: https://brainly.com/question/14323743

1 point
The type of cellular transport shown in the image (to the right) is called

Endocytosis
Exocytosis
Osmosis
Diffusion

Answers

Answer:

Exocytosis

Explanation:

Exocytosis is when a bulk of molecules exit the cell. The arrows indicate that it is leaving the cell.

Answer:

B. Exocytosis

Explanation:

Exocytosis is the process by which vesicles in the cytoplasm fuse with the cell membrane, releasing their contents into the cell's external environment. Cellular wastes are often disposed through this process.

Why do we care how strong a rock is?

Answers

Answer:

hahahahahahahaha

Explanation:

because

Answer:

to throw it at ur cheating bf

Explanation:

lma.o

  °   •  .°•    ✯

   ★ *     °      °·                            

.   • ° ★ •  ☄

▁▂▃▄▅▆▇▇▆▅▄▃▁▂

A plant produces seed cones and pollen cones . Is it vascular? To what group of plants does it belong

Answers

A plant produces seed cones and pollen cones. Belong to plant group
phylum Coniferophyta and Yes it is vascular

A plant that produces seed cones and pollen cones is a vascular plant, and plants that produce seed cones and pollen cones belong to the group of plants known as gymnosperms.

What are gymnosperms?

Gymnosperms are a group of seed plants that produce seeds that are not enclosed in an ovary and produce open seeds that are usually borne in cones and include a variety of plant species, including conifers such as pine, spruce, and fir trees, cycads such as palm-like plants, ginkgoes, etc., and the production of seed cones and pollen cones is a vital characteristic of gymnosperms, these seed cones, which are also called female cones, produce seeds that are typically larger and more complex than pollen grains.

Hence, a plant that produces seed cones and pollen cones is a vascular plant and belongs to the group of plants known as gymnosperms.

Find out more about gymnosperms here.

https://brainly.com/question/15158870

#SPJ2

What is the meaning of the term metabolism?

Answers

Metabolism is the chemical processes that occur within a living organism in order to maintain life. Have a good day! Also, any answer that says, ‘Here is the link to your answer: (link)’ DO NOT CLICK ON IT!!

scientific and common name for this?

Answers

Answer:

The common name for this is Moss

Scientific name is Bryophyta

Explanation:

What are the two most common sources for rivers and streams?

Answers

Answer:The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.

Explanation:I did this in class 2 days ago LOL

Answer:

The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.

Explanation:

Hope this helped you :D

why is this conversion of energy from one molecule to another necessary for all cells?

Answers

[tex]\mathfrak{\huge{\orange{\underline{\underline{AnSwEr:-}}}}}[/tex]

Actually Welcome to the Concept of the energy conversion

=> ATP can be used to store energy for future reactions or be withdrawn to pay for reactions when energy is required by the cell.

=> When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate (ADP).

If there are 60 crayfish living in a pond that is 20 cubic yards, what is the population density?

Answers

Answer:

80

Explanation:

I will mark someone brainliest! Please help!!

Answers

Answer:

The first one

Explanation:

Mark me brainliest please

During cellular respiration, energy is transferred from *
1 point
A. ATP to glucose
B. CO2 to enzymes
c. sunlight to glucose
D. glucose to ATP

Answers

Answer:

a or b I'm sorry but I know it's not c

Answer:

A? im not sure..................

The Moon completes one orbit around the Earth in approximately
in approximately
and completes one cycle of its phases
A 271/3 days, 24 hours
B 24 hours, 24 hours
C 24 hours, 29 1/2 days
D 27 1/3 days, 29 1/2 days

Answers

Answer:

Answer is D

Explanation:

Takes about then to circle the Earth

Answer:

It takes 27 days, 7 hours, and 43 minutes

Explanation:

Which of the following is true about the role of genetic and environmental factors in human health?
A) Genes are the only factor affecting whether or not an idividual will contract a disease.
B) Genetic factors are more important than environmental factors in determining an individual's
personal health risks.
C) Individuals can influence their health by controlling their genetic traits.
D) Environmental factors determine whether or not all genetic traits lead to health issues.
E) Certain environments can lead to an increased risk of developing certain diseases.

Answers

Answer:

E) Certain environments can lead to an increased risk of developing certain diseases.

Explanation:

The lesson states that specific environments can increase the chance of health problems.

I NEEEED HEEELP PLZZZZZZZZ :))

Answers

They would have black and white because grey shows up as lavender or blue in a chicken and it can’t be black or white because it says BW that is together so it would have to be black and white

Answer:

They would have both black and white feathers because codominance means that both genotypes have to be expressed. Gray isn't an apparent (given) trait.

A student examines a periodic table.
Which inferences about sodium (Na) are true?

Answers

Answer:

true c this is the answer

Santos and Lüderitz are the same distance from the equator, and both cities are near the ocean. The air temperature in Lüderitz is colder than the air temperature in Santos. What causes the air temperature in these places to be different? Explain what causes the difference as completely as you can.

Answers

Answer:

The Ocean Currents.

Explanation:

if you look at a current map, you'll see warm currents near Sanots and cold ones near Lüderitz. Therefore, the air in Sanots is a lot warmer and the air in Lüderitz is colder.

The phenomenon of the ocean current is responsible for this deviation of air temperature between two places.

What do you mean by Air temperature?

Air temperature may be defined as the temperature of the surrounding air of organisms including humans.

The ocean water captures the heat from the sunlight and increases the temperature of the ocean. This heat is then entranced through ocean circulation and increases the temperature of the air as well as the atmosphere.

The air temperature in Luderitz is colder because the ocean of this region receives less sunlight in low intensity which results in less heat captured by the ocean and makes the air a little bit colder than that of Santos oceans.

Therefore, it is well described above.

To learn more about Ocean currents, refer to the link:

https://brainly.com/question/1145641

#SPJ2

Why do we want to produce genetically different organisms?

Answers

Answer: Genetically engineered crops produce higher yields, have a longer shelf life, are resistant to diseases and pests, and even taste better.

Explanation:

Everything I think produce organs I think

What percentage of Americans use solar power ?

Answers

Answer:

66.7 percent.

Explanation:

I looked it up and nothing rly said what percentage of Americans use solar power but solar power was used for 2.30% of the total US electricity.

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Answers

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Which function of the integumentary system is illustrated in the release of sweat?
Absorbtion
Protection
Sensory Reception
Regulation
Secretion
Both regulation and secretion

Answers

Answer:

Secretion

Explanation:

Not completely sure tho, good luck

list the planets from smallest to largest

Answers

Answer:

Mercury, Mars, Venus, Earth, Neptune, Uranus, Saturn, and Jupiter

Explanation:

Answer:

Mercury, Mars, Venus, Earth, Neptune, Uranus, Saturn, and Jupiter.

Explanation:

hope this helps!!!:)

SCIENCE ASSAP PLS
what does secondary succession mean in science

Answers

secondary succession is when plants and animals recolonize a habitat after a major ecological disturbance

what happens to most solar radiation when it gets to earth??

Answers

Answer:

Most of the solar radiation is bounced off of earth´s atmosphere.

Explanation:

Due to earth´s magnetic field, we are able to be protected from most of the solar radiation the sun emits.

AHHHH PLS HELPP Which method is better for the environment: the controlled burn (burning oil off of the water) or using the naturally-occuring bacteria?

Answers

Answer:

using the naturally_occuring bacteria

Explanation:

go trying and helping wich with

What happens to chromosomes when an ovum and a sperm meet at fertilisation

Answers

Answer: When egg and sperm cells combine in fertilizations, they merge the two sets of chromosomes, ending up with 46 chromosomes in total. The maternal chromosomes from the egg cell and the paternal chromosomes from the sperm cell pair up. The resultant cell is called a zygote. Fertilization happens when a sperm cell successfully meets an egg cell in the fallopian tube. Once fertilization takes place, this newly fertilized cell is called a zygote. From here, the zygote will move down the fallopian tube and into the uterus. The zygote then burrows into the uterus lining.

Explanation:

White blood cells ingest, then digest, a number of bacteria and other pathogens. White blood cells would require high numbers of which organelle in order to function properly?

Answers

Answer:

Lysosome

Explanation:

Which of the following is an advantage of meiosis and sexual reproduction?
A. Meiosis ensures that offspring will not inherit any genetic disorders.
B. Meiosis ensures that offspring are genetically identical as their parents.
C. Meiosis ensures that offspring will have identical phenotypes to their parents.
D. Meiosis ensures a wider variety of genetic variation.

Answers

Answer:

D. Meiosis ensures a wider variety of genetic variation.

This happens above all thanks to the Crossing over, the process in which the exchange of genetic material during sexual reproduction between two homologous chromosomes' non-sister chromatids results in recombinant chromosomes.

2. How are humans making greenhouse gases of our own?
burning fossil fuels in our cars
burning forests
O all of these

Answers

Answer:

All of them. Plus feeding cows corn instead of grass makes them gassy.

Explanation:

Other Questions
Can someone please help me ? If y varies inversely with x and y=5 when x=6, then what is y when x=3? Please hurry will mark brainlyest. Which obstacle was faced by African Americans serving in the armed forces during World War II?They were forced to serve in segregated units.They were not subject to military conscription.None of them ever saw combat during the war.They were placed under French command. please help me with this PLEASE HELP THIS IS DUE NOW!!!!!In 35 sentences, use the information you have learned about theme to write a theme statement about a story or book you have read. Explain whether the theme from your book relates to any universal themes, and explain why or why not. Find the missing angle or find X? Calculate the pH of each of the following aqueous solutions. (Enter your answers to two decimal places.) (a) 10.0 mL deionized water WebAssign will check your answer for the correct number of significant figures. 2.72 Incorrect: Your answer is incorrect. (b) 10.0 mL deionized water plus 5.0 mL of 0.10 M NaOH WebAssign will check your answer for the correct number of significant figures. (c) 10.0 mL deionized water plus 10.0 mL of 0.10 M NaOH WebAssign will check your answer for the correct number of significant figures. (d) 10.0 mL deionized water plus 15.0 mL of 0.10 M NaOH WebAssign will check your answer for the correct number of significant figures. On the periodic table, in which period is copper? What is the value of z in the equation 10z + 15 = -5 Determine which of the following relations are functions. Select three that apply.{(3, 0), (4, 1), (5, 2), (4, -1)}{(8, 1), (8, 2), (8, 3), (8,4)}{(1, 3), (2, 3), (3, 3), (4, 3)}{(-3, 7), (1, 4), (2, 9), (5, 0);O {(-2,5), (-1, 2), (0, 1), (1, 2)} Which goal did the Founding Fathers have when they created the national government under the Constitution? a, They wanted a government that was strong enough to hold the country together. b, They hoped for a government that would model the government of Great Britain.c, They wanted to establish a government that gave the states more power.d, They wanted to create a government that could control the people. PART B: Which detail from the text best supports the answer to Part A?Poem resisting arrest? Anyone know the answer thanks How many seconds will it take for a the International Space Station to travel 450 km at a rate of 100 m/s? Which statement best describes how the carbon cycle and oxygen cycle are interrelated?Group of answer choicesPlants release water during transpiration and carbon dioxide during photosynthesisPlants use carbon dioxide and release oxygen during photosynthesisAnimals release water during respiration and carbon dioxide during transpirationAnimals use carbon dioxide and release oxygen during respiration Height of tallest wave possible Flash City Inc. manufactures small flash drives and is considering raising the price by 75 cents a unit for the coming year. With a 75-cent price increase, demand is expected to fall by 7,000 units. Current Projected Demand 78,000 units 71,000 units Selling price $9.00 $9.75 Incremental cost per unit $6.80 $6.80 Would you recommend the 75-cent price increase PLEASE HELPPPPPPPPPPPPPPPPPPPP DUE IN 3 MINSSS what does the author tell you about vegetables on this page.