What were the origins and ideals of the new reform religions, and how did they differ from Catholcism and each other?

Answers

Answer 1

The period of the Reformation and Counter-Reformation held many different ideas regarding the Christian religion.

Jesus was of what faith?

Jesus was a Jew, of course. In Galilee, a Jewish region of the world, he was born to a Jewish mother. All of his acquaintances, associates, coworkers, and disciples were Jews. He routinely attended synagogues, places of Jewish communal prayer.

Which religion has a long history?

Despite being the oldest religion in the world, Hinduism is an exonym, and many of its adherents refer to their faith as Santana Dharma.

To know more about Religion visit:

https://brainly.com/question/1463373

#SPJ1


Related Questions

5 major events leading up to Johannes Keplers lifetime?

Answers

The 5 major events leading up to Johannes Kepler's lifetime were Renaissance, Protestant Reformation, Scientific Revolution, discovery of the New World and invention of the printing press.

What events occurred before Johannes Kepler's lifetime?

During the Renaissance, there was a renewed interest in learning and exploration, leading to advancements in various fields such as art, literature, and science. The Protestant Reformation challenged the authority of the Catholic Church and led to religious and political changes across Europe.

The Scientific Revolution brought about a shift in the way people viewed the natural world with the development of scientific methods and discoveries. The discovery of the New World by Christopher Columbus and other explorers opened up new possibilities for trade, colonization, and cultural exchange.

Read more about Johannes Keplers

brainly.com/question/31254676

#SPJ1

Select the name of the correct country on the map.
The creation of which nation is a major cause of the hostility toward the United States by terrorists in the Middle East?
LEBANONS
ISRAEL
EGYPT
Countries in Middle East
GEORGIA
TURKEY
SUDAN
SYRIA
JORDAN
ERITREA
AZERBADAN
ARMENIA
IRAQ
KUWAIT
SAUDI
ARABIA
YEMEN
Casa TURKMENISTAN
IRAN
UZBEKISTAN
QATAR
OMAN
AFGHANISTAN
UNITED ARAB
EMIRATES
KYRGYZSTAN
TAJIKISTAN
PAKISTAN

Answers

The use of deliberate violence and fear to further political or ideological goals is referred to as terrorism in its broadest sense. In this usage, the phrase primarily refers to intentional harm done to noncombatants during times of peace or during armed conflict.

The illegal use of force or violence against people or property with the intention of intimidating or coercing a government or its people to promote specific political or social goals is referred to as terrorism.

Terrorism's main objective is to undermine people's sense of security in the locations they know best.

Learn more about Terrorism here:

https://brainly.com/question/8949816

#SPJ1

Question 7 of 10
Northerners were concerned about expansion because they felt it could
possibly lead to:
A. a system where they would pay more for goods and services.
OB. war with foreign powers over land in the West.
C. new federal policies that would only benefit the South.
D. an attack on their cultural traditions and economy.

Answers

Northerners have been concerned about west expansion due to the fact they feared it may cause wars with overseas powers over land in the West. Therefore option B is correct one.

They also feared that the spread of slavery in to new territories would tip the balance of power in Congress closer to the slave holding South and also potentially lead to a competition for the land and the assets of the country, that can increase tensions between the North and South.

Moreover, the 1850 Fugitive Slave Act heightened Northerners' fears and opposition to westward expansion.

Learn more about Northerners:-

https://brainly.com/question/15083249

#SPJ1

‼️‼️WILL MARK BRAINLIEST IF HELPFUL‼️‼️

Answers

Answer:

Explanation:

t seems that the provided situations are missing the possible reactions for each country. However, based on the given information, we can make an assessment of the potential policy approaches:

After a huge earthquake and tsunami, with Country B being very poor and unable to provide for the homeless population, an internationalist policy approach would involve seeking assistance and support from other countries and international organizations to help with the humanitarian crisis. This would involve collaboration and coordination with other nations to address the immediate needs and provide resources and aid.

In the case of Country R's concern about the rainforest being cut down in Countries F, G, and H, an internationalist policy approach would involve engaging in diplomatic efforts to raise awareness about the importance of rainforest preservation. Country R may collaborate with other nations, international environmental organizations, and support sustainable development initiatives to mitigate the loss of the rainforest and promote job opportunities in alternative sectors.

It's important to note that the given situations do not provide specific reactions or policies for each country. The categorization of isolationist, internationalist, or something in between would require a more detailed understanding of the countries' specific actions and policies.

What are the four European Nationals who traded on the coast of Sierra Leone before 1800

Answers

Before the 1800s, the British, Portuguese, French, and Dutch were four European Nationals who traded on the coast of Sierra Leone.Sierra Leone was a British Colony for a long time and the Atlantic slave trade was operated from its coastlines. Initially, the British used Sierra Leone to transport slaves to the Americas, but later, they established trading posts to trade in gold, ivory, and other goods from the interior of the continent.

The Portuguese were the first Europeans to visit Sierra Leone's shores, during the 15th century. They soon established a thriving trade relationship with the coastal people. Trading in gold, ivory, and other items, they went to inland markets and procured goods for export. The French arrived at around the same time and established trading posts along the coast.

They were interested in ivory, gold, and other goods as well, and so they entered into trade relationships with Sierra Leoneans. Dutch traders were also interested in trading gold and ivory, but they were especially interested in trade slaves, and so they established slave trading posts all around the coast of Sierra Leone. They were infamous for their harsh treatment of slaves, and their trading network was large and lucrative.

For more questions on: Portuguese

https://brainly.com/question/9404857

#SPJ8

VA & US Next (2015) / SECTION 1 / 6 OF 50/-
The Three-Fifths Compromise was primarily developed to gain the support of
O A. Mid-Atlantic merchants
O
B. New England businessmen
C. Western fur traders
20%
O D. Southern plantation owners

Answers

The Three-Fifths Compromise was developed during the Constitutional Convention in 1787 as a way to determine how enslaved individuals would be counted for representation and taxation purposes. Hence D is correct.

Southern plantation owners supported the compromise because they wanted to ensure that enslaved individuals were counted as part of their state's population, which would give them greater representation in the Constitutional  House of Representatives. At the same time, they also wanted to avoid being taxed for the full number of enslaved individuals in their state.

2 The compromise determined that each Constitutional  enslaved individual would be counted as three-fifths of a person for both representation and taxation purposes.

This compromise was crucial in gaining the support of Southern states and ultimately led to the adoption of the United States Constitution.

Learn more about Southern plantation owners here

https://brainly.com/question/20949490

#SPJ1

What has Western civilization today, derived from the ancient civilizations of the Near East?

Answers

Answer:

Many elements of ancient near Eastern civilization were passed on to the West. The wheeled vehicle, the plow, and the phonetic alphabet-all important to the development of civilization-derive from the near East.

Explanation:

Which Enlightenment philosopher believed that if the people did not like their government they had the right overthrow it? A. Hobbes B. Locke C. Rousseau​

Answers

Answer:

B. Locke

Explanation:

Locke believed that there existed a social contract between the government and the people in which people give the government power to rule in exchange for their protection. If the government became corrupt and tyrant John Locke believed that people have the power to overthrow this government

Question 5 of 5
Which phrase best completes the diagram showing the growth of the Mongol
Empire?
United
nomadic
groups in
Mongolia
Conquered
Muslim
territory in
Central Asia
?
A. Captured northern China and southern Russia
B. Conquered a powerful empire in India
C. Built a huge army in northern Africa
D. Formed an alliance with western European kings
Captured
Korea,
southern China,
and parts of
eastern Europe

Answers

A. Captured northern China and southern Russia

The phrase that best completes the diagram showing the growth of the Mongol Empire is A. Captured northern China and southern Russia.

After uniting nomadic groups in Mongolia and conquering Muslim territory in Central Asia, the Mongol Empire expanded its reach by capturing parts of northern China and southern Russia.

This was a significant milestone in the empire's growth and demonstrated the power of the Mongol military. Additionally, the Mongol Empire went on to capture Korea, southern China, and parts of eastern Europe, further solidifying its status as a dominant force in the region.

For more such questions on northern China, click on:

https://brainly.com/question/30593002

#SPJ11

what year poland regain independence​

Answers

The answer is: November 1918

If Jabez were applying for a car loan, what type of data privacy law would affect what type of information was available about this credit history? (1 point) O FCRA O HIPAA O COPPA O FTCA​

Answers

If Jabez were applying for a car loan, the data privacy law that would affect the type of information available about his credit history is the FCRA (Fair Credit Reporting Act).

The Fair Credit Reporting Act (FCRA) is a federal law in the United States that regulates the collection, dissemination, and use of consumer credit information.

It ensures the privacy, accuracy, and fairness of credit reporting systems. Under the FCRA, consumer reporting agencies (credit bureaus) are required to maintain the confidentiality of individuals' credit information and only disclose it for permissible purposes, such as credit evaluation for loans or employment background checks.When Jabez applies for a car loan, the lender may request his credit history from a consumer reporting agency. The FCRA sets guidelines on what type of information can be shared, how it should be handled, and the rights of consumers to access and dispute any inaccuracies in their credit reports.

It aims to protect individuals' privacy by ensuring that their credit information is handled responsibly and confidentially, while also promoting fair and accurate credit reporting practices.

For more questions on privacy law

https://brainly.com/question/14578050

#SPJ8

Testament of Moldavian Princess Maria (Lupu) Radziwill from 1659

Tell me a plot summary of this.

Answers

Maria Radziwi, a patroness of Moldavia and the wife of the Lithuanian Grand Hetman Janusz Radziwi, was born Maria Lupu in Moldavia around 1625 and passed away on January 14 or 15 in Lutsk, Poland-Lithuania Commonwealth.

Johann Schretter's picture of Maria Lupu and her ex-wife Katarzyna Potocka 1646 Maria was the daughter of Todoşca Costea Soldan and Moldavian voivode Vasile Lupu. Her half-brother Tefăniță Lupu became the Prince of Moldavia, while her sister Ruxandra married the military commander Tymofiy Khmelnytsky. Maria obtained a formal education, picking up the Greek and Latin languages as well as Polish later on.

After the passing of his first wife Katarzyna in 1645, she wed Janusz Radziwi, the Grand Chamberlain of the Grand Duchy of Lithuania. Maria entered the marriage with a dowry from her father; from her husband, she received 45,000 Zloty, as well as diamonds, gold, and silver valued at 15,000 Zloty, and some land from the Polish monarch Wadysaw IV Vasa. The honeymoon was spent in Italy by the newlyweds.

Her Protestant husband established a little Orthodox monastery in Kdainiai in 1652, and Maria's father and she contributed to the inventory. Following Janusz Radziwi's passing in 1655, Maria fought a protracted legal battle over a portion of his estate that was ultimately unsuccessful.

Orthodox churches in Poland, Lithuania, and the Principality of Moldavia were financed by Maria Radziwi. She left the Holy Spirit Monastery in Vilnius 200,000 Zoty, 13 other monasteries, 7 churches, hospitals, and other institutions in her testament from November 1659.She was laid to rest in Lutsk's Orthodox Trinity Monastery. Concerns arose around her additional inheritance as well.

Many different people have portrayed Maria Lupu Radziwi. There are at least eight surviving paintings and engravings.

Her zinc casket was taken out of the Trinity Monastery in Lutsk in 1917. The Romanian embassy in Lithuania has been holding the Maria Lupu-Radvilien Essay Contest in Kdainiai, where she spent a significant amount of time, since 2018.

To know more about Moldavia, click:

https://brainly.com/question/14987324

#SPJ1

What were the goals of Allied bombing runs over Germany?

Answers

The primary goal of Allied bombing runs over Germany during World War II was to cripple the country's industrial capacity and weaken its ability to wage war. This was accomplished by targeting key factories, transportation networks, and military installations, as well as cities and civilian populations.

The bombing campaigns were also meant to divert German resources and manpower away from the front lines, forcing the country to fight a two-front war. Additionally, the psychological impact of sustained bombing was intended to demoralize the German people and break their will to continue the war effort.

However, the Allied bombing campaign was not without controversy and criticism. Many argue that the bombing of civilian populations, particularly in cities like Dresden, was excessive and immoral. Despite these criticisms, the bombing campaigns played a significant role in the eventual defeat of Germany and the end of World War II.

For more question on campaigns

https://brainly.com/question/30104473

#SPJ11

Describe the Manhattan Project and the resulting atomic bombings.

Answers

The Manhattan Project was a top-secret research and development program undertaken by the United States during World War II. Its goal was to develop atomic weapons, specifically the atomic bomb, which could be used as a powerful military tool.

The project began in 1939 and brought together leading scientists, engineers, and military personnel. It operated under intense secrecy and involved multiple research facilities, including Los Alamos, New Mexico. The project was funded by the U.S. government, with the full support of President Franklin D. Roosevelt.

After several years of research and testing, the Manhattan Project successfully produced two atomic bombs: "Little Boy" and "Fat Man." On August 6, 1945, the United States dropped the "Little Boy" bomb on the city of Hiroshima, Japan. The explosion resulted in massive destruction and the immediate deaths of tens of thousands of people.

Three days later, on August 9, 1945, the United States dropped the "Fat Man" bomb on the city of Nagasaki, Japan. This second atomic bombing caused similar devastation and loss of life.

The atomic bombings of Hiroshima and Nagasaki were the first and, so far, the only instances of nuclear weapons being used in warfare. The bombings played a significant role in Japan's surrender on August 15, 1945, effectively ending World War II.

The bombings had a profound and long-lasting impact, raising ethical and moral questions about the use of such destructive weapons. They also marked the beginning of the nuclear arms race between the United States and the Soviet Union, which defined much of the Cold War era. The bombings served as a stark reminder of the destructive power of atomic weapons and the need for international efforts to prevent their use in future conflicts.[tex][/tex]

Which scenario describes a federal court going against the principle of precendent?

Answers

The scenario which  describes a federal court going against the principle of precedent option A. A federal judge rules that newspapers may be censored during an emergency despite earlier courts declaring this practice unconstitutional.

A federal judge ruling that newspapers may be censored during an emergency despite earlier courts declaring this practice unconstitutional is an example of a precedent-breaking federal court decision. In legal systems, the situation in which a legal case serves as a precedent because it establishes a principle or rule is referred to as the principle of precedent. The correct option is A.

The case Brown v. Board of Education is one example of a precedent in law. Because it established that racial segregation within the public school system was against the Constitution, this case became a precedent. Points of reference are then utilized as models for comparable cases that will occur from here on out.

DISCLAIMER The question is incomplete.

Which scenario describes a federal court going against the principle of precedent?

A. A federal judge rules that newspapers may be censored during an emergency despite earlier courts declaring this practice unconstitutional

B. A state supreme court overturns a defendant’s conviction on the grounds that the judge for his first trial demonstrated a bias against him

C. A court rules that a state is allowed to racially segregate restrooms because earlier courts ruled in favor of segregated buses.

D. A defendant convicted of a federal crime appeals to the Supreme Court, but his request is denied

To learn about federal court

https://brainly.com/question/29615892

#SPJ1

Which of the four main causes of the Great War mostly contributed to the beginning of WW1, Militarism, Alliances, Nationalism, or Imperialism? Explain your answer.

Answers

Imperialism was the factor that mostly contributed to the beginning of World War I.

Which of the four main causes of the Great War is most effective?

Imperialism played a significant role in sparking the outbreak of World War I. During this period, the major European powers were engaged in fierce competition for colonies and territories around the world.

This scramble for resources and dominance led to heightened tensions among nations as each sought to expand their empires and secure their economic interests. The competition for colonies particularly in Africa, intensified rivalries and created a hostile environment among the European powers.

Read more about Great War

brainly.com/question/27400269

#SPJ1

Which individual helped found the National Negro Business League?​

Answers

Answer: Booker T. Washington

Explanation: <3

3.
How is George Jr. similar and different from his father?

Answers

King George VI had a very different personality and approach to ruling compared to both his father, King George V, and his brother, King Edward VIII. King George V was known for his strict adherence to tradition and his desire to maintain the power and prestige of the monarchy. He was also very reserved and formal in his interactions with the public.

King Edward VIII, on the other hand, was known for his flamboyant lifestyle and his desire for personal freedom. He was seen as a modernizing force within the monarchy, but his reign was short-lived due to his abdication in 1936.
In contrast, King George VI was known for his modesty, humility, and sense of duty. He was a reluctant king who never sought the throne but accepted it when it was thrust upon him. He was also known for his compassion and his ability to connect with the common people.
Overall, King George VI was seen as a more modern and approachable monarch compared to his father and brother. He was able to navigate the challenges of World War II and the changing social landscape of post-war Britain with grace and dignity, and he remains a beloved figure in British history.

For more such question on King George VI

https://brainly.com/question/26098957

#SPJ11

Which is true about the experiences of Okies living in California
A. Life was greatly improved for Okies in California
B. California welcome to Okies since farm workers were in great demand
C. Cookies were able to buy plenty of land at affordable prices.
D. Cookies competed with local workers to pick crops at starvation wages

Answers

the answer is B because farm workers were greatly appreciated

An auto transport truck holds 12 cars. A car dealer plans to bring 1,150 new cars in June and July. If an auto transport truck is filled for each delivery, except for the last one, how many full truckloads are needed and how many cars will be in the last truck

Answers

The car dealer will need 191 full truckloads and the last truckload will have 8 cars.

The number of full truckloads needed and the number of cars in the last truck, we can use the following steps:

Calculate the total number of cars that need to be transported:

1,150 cars in June + 1,150 cars in July = 2,300 cars.

Calculate the number of full truckloads:

Divide the total number of cars by the number of cars a truck can hold.

2,300 cars ÷ 12 cars per truck = 191.67 truckloads.

Since we cannot have a fraction of a truckload, we'll consider the whole number part (191) as the number of full truckloads.

Calculate the number of cars in the last truckload:

Multiply the number of full truckloads by the number of cars a truck can hold and subtract it from the total number of cars.

191 truckloads × 12 cars per truck = 2,292 cars.

Then, 2,300 cars - 2,292 cars = 8 cars.

For similar questions on truckload

https://brainly.com/question/29638426
#SPJ11

On the memoir Incidents in the Life of a Slave Girl:

Giving specific examples from the book, explain the slave culture that developed from the inhumanity of slavery. Next, what power relations does the author depict in the slave system, and how are they significant? Finally, how does the book help define the foundation and contours of racism in early 19th century America (and into the future)?
Minimum Requirements: Your paper will be a 4-6 page

Answers

The role of gender in the slave system and how it impacted power relations including the sexual exploitation of enslaved women by their masters.

The book reveals the intersections of racism patriarchy and capitalism in early 19th-century America.

I apologize but writing a 4-6 page paper on the topics you've mentioned is beyond the scope of what I can provide here.

I can provide you with a brief overview of the points you can explore in your paper on the memoir "Incidents in the Life of a Slave Girl" by Harriet Jacobs:

Slave Culture:

Explore the dehumanizing aspects of slavery depicted in the book such as physical abuse sexual exploitation and separation of families.

Discuss the psychological impact of slavery on enslaved individuals, including the loss of autonomy constant fear and the development of survival strategies.

Highlight specific examples from the book that illustrate the resilience resourcefulness and community support within slave culture.

Power Relations in the Slave System:

Analyze the power dynamics between enslaved individuals and slaveholders emphasizing the absolute control exerted by slaveholders over the lives and bodies of the enslaved.

Discuss the role of gender in the slave system and how it impacted power relations including the sexual exploitation of enslaved women by their masters.

Explore the complexities of power within enslaved communities such as the roles of overseers slave drivers and enslaved individuals who may have held positions of authority.

Foundation and Contours of Racism:

The book highlights the inherent racism embedded in the institution of slavery emphasizing the devaluation of Black lives and the justification of slavery through racial stereotypes.

Analyze how the book exposes the systemic nature of racism demonstrating how it permeated various aspects of society and affected both enslaved and free Black individuals.

Remember to support your arguments with specific examples and quotations from the book to provide evidence for your analysis. Additionally it's important to engage with secondary sources and scholarly interpretations to enhance the depth of your paper.

For similar questions on slave

https://brainly.com/question/9374853

#SPJ11

Conducting Foreign Policy, interstate trade, and running the federal reserve are all examples of ___ federal powers

Answers

Conducting Foreign Policy, interstate trade, and running the federal reserve are all examples of enumerated federal powers.

Conducting Foreign Policy, interstate trade, and running the federal reserve are all examples of enumerated federal powers.

Enumerated powers are specifically listed and granted to the federal government by the Constitution.

These powers are outlined in Article I, Section 8 of the United States Constitution, which grants Congress the authority to regulate commerce among the states, establish foreign policy, and manage the monetary system.

The federal government has the exclusive authority to engage in diplomatic relations with other nations, negotiate treaties, and maintain trade agreements.

It also has the power to regulate interstate commerce, ensuring fair trade practices and promoting economic stability.

Additionally, the federal government is responsible for overseeing the nation's monetary policy through the operation of the Federal Reserve System, which manages the country's banking system and influences economic conditions.

For more such questions on Federal powers:

https://brainly.com/question/4706861

#SPJ11

How many colonies did English control at the start of the French and Indian war?

Answers

Answer:

Explanation:

At the start of the French and Indian War (1754-1763), the English (also known as the British) controlled thirteen colonies in North America. These colonies were located along the eastern seaboard of what is now the United States and included Massachusetts, New Hampshire, Connecticut, Rhode Island, New York, New Jersey, Pennsylvania, Delaware, Maryland, Virginia, North Carolina, South Carolina, and Georgia.

PLS MARK ME BRAINLIEST

which of the following best describes the homestead act?

A. It was a grant of 160 acres given to settlers that remained five year
B. It redistributed the lands in the south after the civil war
C. It converted plantations into subdivisions and small towns
D. It was an interest free loan of $5,000

Answers

It converted plantations into subdivisions and small towns: which best describes the homestead act. Thus, option C is the correct option.

The Homestead Act changed plantations into tiny towns and subdivisions. The Homestead Act passed in 1862 during the Civil War, allowed any adult citizen or intending citizen who had never engaged in armed conflict with the American government to claim 160 acres of surveyed public land.

Claimants had to occupy the property, maintain it by farming, and otherwise "improve" it. A claim for up to 160 acres of free federal property may be submitted by any American, even freed slaves, under the 1862 Homestead Act, which hastened the colonization of American western territory.

Learn more about the homestead act here:

https://brainly.com/question/10390487

#SPJ1

which factor contributed to the start of the European renaissance

Answers

Answer:

In conclusion, historians have identified several causes of the Renaissance in Europe, including: increased interaction between different cultures, the rediscovery of ancient Greek and Roman texts, the emergence of humanism, different artistic and technological innovations, and the impacts of conflict and death.

The cyclically adjusted budget balance is defined as what the federal budget would be if:


real GDP were greater than potential GDP


the tax rate were proportional or flat


unplanned changes to inventories were zero


the marginal propensity to consume were greater than 1


real GDP equaled potential GDP

Answers

The cyclically adjusted budget balance is defined as what the federal budget would be if real GDP were equal to potential GDP and unplanned changes to inventories were zero, assuming a proportional or flat tax rate.

The cyclically adjusted budget balance is a measure of the federal government's fiscal position that takes into account the impact of the business cycle on government revenues and expenditures. It is calculated by adjusting the actual budget balance for the effects of changes in the business cycle.

Specifically, the cyclically adjusted budget balance assumes that the economy is operating at full employment, which means that real GDP is equal to potential GDP. Additionally, it assumes that unplanned changes to inventories are zero, which helps to isolate the effects of the business cycle from other factors that may affect the federal budget.

To know more about federal budget , click here

https://brainly.com/question/31813554

#SPJ1

help me

Each position advertised by an employer lists specific __________.
A.
options
B.
wishes
C.
alternatives
D.
requirements


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

wishes

Explanation:

B is the answer B is wishes

of all the arguments presented by the greeks as a proof that earth is spherial, which among you find more convincing? why?

Answers

Answer:

I do not have personal beliefs or opinions. However, I can present some of the arguments that the Greeks presented as proof that the Earth is spherical.

One of the most famous arguments comes from the Greek philosopher Aristotle, who observed that during a lunar eclipse, the Earth's shadow on the Moon is always curved. This curved shadow can only be explained if the Earth is round, and not flat.

Another argument comes from the Greek mathematician Eratosthenes, who measured the angles of the shadows cast by two different obelisks in Alexandria and Aswan at the same time of day. From these measurements, he was able to calculate the circumference of the Earth. The fact that the measurements were different could only be explained if the Earth was curved.

Additionally, the Greeks noticed that as ships sailed away from the shore, the hulls of the ships would disappear first, followed by the masts. This phenomenon could only be explained if the Earth's surface curved away from the observer, as it would if the Earth were spherical.

Overall, these and other arguments presented by the Greeks provide compelling evidence that the Earth is a sphere.

Many students walk away from this class wondering why our founding beliefs of "liberty and equality" have not been met. After so many years of reform movements, and progress many individuals in this nation do not experience a satisfied level of liberty and/or equality. Using any details and examples from this course, trace the advances made towards individual "liberty and equality" and hypothesis what it will take to obtain a greater level of liberty and equality in our nation in the future.

Answers




Liberty and equality are at the very core of our American identity. We seek to have the liberty to live our life and to be treated equally under the law; and we have fought countless battles to achieve this ideal. We have made great strides in advancing liberty and equality for all in our society, but there are still many challenges ahead that we must face to ensure freedom and fairness for all Americans. A greater level of liberty and equality will require our continued commitment to civil and human rights, and to ensuring that all persons are treated equally and with respect under the law.

Imagine that you are a union leader writing a letter to the manager of the factory where you work. In the letter, you should request specific reforms and changes in working conditions and explain why they are necessary. Refer to the previous readings and remember to think about the following things as you write:

Answers

Answer:

Its C

Explanation:

Other Questions
determine the total electric potential energy that can be stored in a 16.00 microfarad capacitor when charged using a potential difference of 206.0 v. The solubility of calcium phosphate is 2. 21 x 10- 4 g/L. What are the molar concentrations of the calcium ion and the phosphate ion in the saturated solution? (Molecular wt of calcium phosphate = 310. 18 g/mole) A U.S. public company reported $8 million of goodwill in last year's balance sheet. How should the company calculate its reported goodwill for the current year?A. Determine whether the fair value of the reporting unit is less than the carrying amount and if so reduce the balance of goodwill and report an impairment loss on goodwill in the income statement.B. Calculate the yearly amortization, reduce the beginning balance, and report the current year's amortization expense.C. Determine whether the fair value of the reporting unit is greater than the carrying amount and if so increase the amount of goodwill and report the recovery of any previous impairment in the income statement.D. Determine whether the fair value of the reporting unit is greater than the carrying amount and if so increase the balance of goodwill and report a gain on goodwill in the income statement. c does not provide complete support for abstract data types What is the range of the circle above? earlier debates about divorce concerned the well-being of young children whose lives were disrupted by divorce. in the near future, debates about divorce will likely focus on ________. For the most part, the people who left Europe to settle elsewhere were In ____________________ connections, your computer dials up and connects to your ISP's computer only when needed.A. AepanetB. BroadbandC. Dial-upD. Bandwidth cheng is making a trip to her safe deposit box. what is she most likely planning to do?group of answer choices suppose the population of bears in a national park grows according to the logistic differentialdp/dt = 5P - 0.002P^2where P is the number of bears at time r in years. If P(O)-100, find lim Po) A study of blood pressure and age compares the blood pressures of men in three age groups: less than 30 years, 30 to 55 years, and over 55 years. Select the best method to analyze the data. a. Wilcoxon rank sum test b. Mann-Whitney test c. Kruskal-Wallis test d. Wilcoxon signed rank test Suppose that you borrow $10,000 on a 60-month car loan at 6.25% APR. Compute the monthly payment. a. Set up an equation for the problem using the following variables: n i pv pmt fv; where n=number of periods and i= interest rate per periodWhat is the actual formula?Does this one work? Part of a homeowner's insurance policy covers one miscellaneous loss per year, which is known to have a 10% chance of occurring. If there is a miscellaneous loss, the probability is c/x that the loss amount is $100x, for x = 1, 2, ...,5, where c is a constant. These are the only loss amounts possible. If the deductible for a miscellaneous loss is $200, determine the net premium for this part of the policythat is, the amount that the insurance company must charge to break even. if the enzyme-catalyzed reaction e s es e p is proceeding at or near the vmax of e, what can be deduced about the relative concentrations of s and es What is the floor of the House and Senate chambers?1. the place in each chamber where members of Congress vote on whether bills should be laws2. the place in each chamber where members of Congress stand to talk to constituents3. the place in each chamber where members of Congress give speeches about bills4. the place in each chamber where members of Congress investigate the possible effects of a bill Minerals can be classified based on cleavage or fracture. These two properties refer to the way in which a mineral tends to break. Cleavage is an orderly breakage in well-defined planes. It means that the broken piece of mineral will have flat and smooth sides. Fracture is a random breakage. If a mineral breaks with rough, random, uneven surfaces, it is said to have fractured. Because each of your mineral samples have already been broken from another, larger piece of a mineral, you should be able to tell if it has cleavage or fractures by looking at its sides. Of your 10 minerals, identify three that experienced cleavage. a cube-shaped gray mineral with smooth faces and sharp edges,a rust-colored mineral with a rough, uneven surface In "Bowling Alone," Robert Putnam discusses the reduced amount of social activity and civic engagement among U.S. adults during the past 40 years. Democratic governance, some have argued, depends to some degree on civic engagement and the social capital that it engenders. Putnam advances a number of reasons for the decline in civic engagement or the increase in "Bowling Alone." A leading hypothesis is that television viewing a solitary activity has replaced social activity as a primary form of leisure activity. The article was written a while ago. Today, he might extend that hypothesis to include the extent to which social media replaces conversation and social activity. Building on this information, please answer the following questions.1. What is the dependent variable in the hypothesis regarding television viewing?2. What is the independent variable in the hypothesis regarding social media?3. What is the hypothesized direction of the association between the independent and dependent variable in the social media hypothesispositive, negative, null, or the direction of association cannot be determined?4. In a sentence or two, please explain your reasoning for your answer in c.5. What is the null hypothesis for the hypothesis regarding TV viewing and civic engagement? the sequence of part of an mrna transcript is 5augcccaacagcaagaguggugcccugucgaaggag3 what is the sequence of the dna coding strand? how are the shapes alikei need to know When performing a nutrition assessment, the practitioner should include what information as part of the patient's food and nutrition history?