What provides structure for plants

Answers

Answer 1

Answer:

cell walls

Explanation:

Cell walls provide structure for plants. Cell walls are rigid structures that surround plant cells and provide support and protection. They are made of cellulose and other materials and help maintain the shape and structure of the plant. In addition to cell walls, plants also have a variety of specialized tissues and structures that provide support, including stems, roots, and leaves. These structures work together to help the plant maintain its shape and stand upright, even in the face of wind, rain, and other environmental factors.


Related Questions

Match each pair of orbiting bodies with the attribute they share.


gas giant and ice giants

asteroids and terrestrial planets

comets and ice giants

meteoroids and asteriods
Match these ^ to below
_________________________________________________________
bodies composed primarily of frozen gases

planets composed of lighter elements and compounds

bodies composed primarily of metal and rock

rocky and metallic bodies smaller than planets

Answers

gas giant and ice giants - bodies composed primarily of frozen gases

asteroids and terrestrial planets - rocky and metallic bodies smaller than planets

Comets and ice giants are bodies made mostly of frozen gases.

meteoroids and asteroids - rocky and metallic bodies smaller than planets

What are meteoroids and asteroids?

Meteoroids and asteroids are both types of small celestial objects that orbit the Sun.

Meteoroids are rocky or metallic objects that are smaller than asteroids, ranging in size from tiny grains to about 10 meters in diameter. They are the debris left behind by comets or collisions between asteroids, and they are found throughout the solar system.

Asteroids, on the other hand, are larger, rocky or metallic objects that can range in size from a few meters to hundreds of kilometers in diameter. They are also known as minor planets and are mainly found in the asteroid belt, which is located between the orbits of Mars and Jupiter.

To know more about Asteroids, visit:

https://brainly.com/question/19161842

#SPJ1

Answer:

bodies composed primarily of frozen gases - comets and ice giants

planets composed of lighter elements and compounds - gas giants and ice giants

bodies composed primarily of metal and rock - asteroids and terrestrial planets

rocky and metallic bodies smaller than planets - meteoroids and asteroids

Explanation:

trust :)

why does the level of co2 affect the global temputure

Answers

Without carbon dioxide, Earth's natural greenhouse effect would be too weak to keep the average global surface temperature above freezing. By adding more carbon dioxide to the atmosphere, people are supercharging the natural greenhouse effect, causing global temperature to rise.

FILL IN THE BLANK. The sympathetic nervous system arouses us for action and the parasympathetic nervous system calms us down. Together, the two ___ systems make up the ___ nervous system.

Answers

We are awakened for action by the sympathetic nervous system, and we are calmed by the parasympathetic nervous system. This same autonomic nervous system is comprised of the two systems combined.

The nervous system is what?

The nervous system is made up of the brain, intervertebral discs, and a complex network of nerves. This route is the link between the neurons and the muscles. The brain controls every physical process. The vertebral column descends down the spine beginning with the brain.

What is within the nervous system's control?

The neurological system carries signals sent by the brain towards other bodily components, including the major organs. Thus, the activity of the neural system controls a number of processes, such as the ability to move, breathe, see, as well as communicate.

To know more about nervous system visit:

https://brainly.com/question/29355295

#SPJ4

if you were to look at rose of a jason lights blinking on and off sequentially your brain perceives motion______

Answers

if you were to look at the rose of a jason lights blinking on and off sequentially your brain perceives motion as the lights turn on and off in a sequence.

Even though each individual light is stationary, the pattern of sequential flashing creates the illusion of movement. This phenomenon is known as apparent motion, and it is a type of visual illusion that can create the perception of motion where there is none.

Apparent motion is a visual phenomenon that occurs when two or more stationary images are presented in rapid succession. The brain perceives a continuous motion between the images, even though there is no actual physical movement. This type of motion perception is also known as "phi phenomenon", and it is a fundamental aspect of the way we perceive visual information.

Know more about light here: https://brainly.com/question/29994598

#SPJ4

The process of translation in both prokaryotes and eukaryotes requires tRNAS, amino acids, and ribosomal subunits. Which of the following components must also be present for translation to proceed?
A)polymerases and GTP
B) protein factors and GTP
C)protein factors and ATP

Answers

Both eukaryotes and prokaryotes need tRNAs, amino acids, or ribosomal subunits for the process of translation.

Which amino acid and tRNA are attached to a polypeptide chain at which site?

The expanding polypeptide chain containing amino acids is held in place by the tRNA by the P site, also known as the peptidyl site. The specific amino acid that will be added to a polypeptide chain is stored in the aminoacyl rna, which the A sites (acceptor site) binds to.

What function does tRNA play in translation?

Particularly in the translation process of protein synthesis, tRNA is involved. As the name implies, it transports amino acids into the ribosome so that they can be assembled in the proper sequence to produce the necessary protein.

To know more about prokaryotes visit:

https://brainly.com/question/29119623

#SPJ4

Which of the following is a plausible reason that explains why extreme halophiles can tolerate high salt conditions?
A. they can accumulate compatible solutes, such as glycerol and sucrose, in their cytoplasm
B. they can prevent the entrance of protons in their cytoplasm
C. they have less porins or transport proteins, which makes them less permeable to solutes
D. they have more saturated fatty acids in their membranes than unsaturated fatty acids
E. they have more unsaturated fatty acids in their membranes than saturated fatty acids

Answers

The correct answer is option E:  Halophiles have more unsaturated fatty acids in their membranes than saturated fatty acids is a plausible reason that explains why extreme halophiles can tolerate high salt conditions.

Extreme halophiles can tolerate high salt conditions due to their membranes which contain more unsaturated fatty acids than saturated fatty acids.

Unsaturated fatty acids are more rigid, which allows them to resist the osmotic pressure that higher salt levels bring. Additionally, these unsaturated fatty acids reduce permeability, which allows the extreme halophiles to resist the entry of solutes into their cytoplasm.

The other options are not correct because they do not refer to the membrane composition of extreme halophiles.

Learn more about halophiles:

https://brainly.com/question/6529990

#SPJ4

To measure primary productivity in a grassland ecosystem, you should _____.
A). exclude consumers; periodically mow, collect, and weigh the plants; and calculate plant biomass production per unit time
B). measure the solar energy influx to the site
C). measure the growth of all of the consumers in the system
D). measure the total biomass of organisms per unit area

Answers

A). keep customers out; mow, collect, & weigh the plants on a regular basis; and compute plant biomass production every unit time.

By monitoring peak above-ground biomass, above-ground net primary production (NPP) may be calculated in many temperate & annual grasslands.

Productivity in ecology refers to the rate at which energy, in the form of biomass, is added to a bodies of organisms. Simply said, biomass is the quantity of material that an organism or collection of organisms store in their body. In general, the biomass of cultivated land is equivalent to that of temperate grassland. The largest total primary productivity is seen in coral reefs and algal beds, as shown in the graph. The net primary production of an estuarine ecosystem is approximately twelve times greater than that of the open ocean.

Learn more about biomass

https://brainly.com/question/21525417

#SPJ4

which list includes major events in the history of life on earth in the proper order, from earliest to most recent? A. first prokaryotes, photosynthesis, colonization of land by plants and fungi, first eukaryotes B. first eukaryotes, photosynthesis, colonization of land by plants and fungi, first prokaryotes D. first prokaryotes, first eukaryotes, photosynthesis, colonization of land by plants and fungi
E. first prokaryotes, photosynthesis, first eukaryotes, colonization of land by plants and fungi

Answers

The proper order of major events in the history of life on Earth, from earliest to most recent, is:

A. first prokaryotes, photosynthesis, colonization of land by plants and fungi, first eukaryotes.

The fossil evidence and molecular data are only two examples of the many lines of evidence that support this sequence, which is widely recognized in the scientific world. Around 3.5 billion years ago, the first prokaryotes are thought to have appeared, followed by the development of photosynthesis, which dramatically changed the chemistry of the atmosphere and seas. Approximately around 500 million years ago, plants and fungi began to colonize the earth, which opened the door for the diversity of life on land. Last but not least, the earliest eukaryotes, or complex cells with a nucleus as well as other membrane-bound organelles, first formed roughly 2 billion years ago, perhaps as a consequence of a symbiotic connection between many prokaryotes.

To know more about fossil evidence:

https://brainly.com/question/11830342

#SPJ4

fill in the blank. pollen grains develop in the___of both gymnosperms and angiosperms. please choose the correct answer from the following choices, and then select the submit answer button. answer choices microphyll microsporangium micropyle megastrobilus megasporangium

Answers

Answer: microphyll

Explanation:

An anion is found in greater concentration inside the cell than outside. Which of the following statements BEST describes forces acting on the anion at the resting membrane potential (-70 mV)?
A) The chemical force is directed into the cell and the electrical force is directed out of the cell.
B) Both the chemical and electrical forces are directed out of the cell.
C) The chemical force is directed out of the cell and the electrical force is directed into the cell.
D) Both the chemical and electrical forces are directed into the cell.
E) There is insufficient information to answer this question.

Answers

The option that tells us of the force that is acting on the membrane potential is: Both the chemical and electrical forces are directed into the cell.

What is an anion?

An anion is a negatively charged ion, which is formed when an atom gains one or more electrons. This results in an excess of negatively charged particles, giving the ion a net negative charge.

Anions are important in many chemical reactions and are commonly found in salts, acids, and other compounds. Examples of anions include chloride (Cl-), sulfate (SO42-), and nitrate (NO3-).

Read more on anion here:https://brainly.com/question/28971609

#SPJ1

FILL IN THE BLANK. The basis of the buffering capacity of the respiratory system is based on the addition and/or removal of ________ to the body fluids which raises or lowers pH.

Answers

The basis for the respiratory system's ability to act as a buffer seems to be the intake and/or removal of CO2, which increases or lowers the PH of body fluids.

Which 4 body fluids are there?

According to humoralism, a person's disposition was determined by their body's four fluids—blood, yellow bile, black bile, as well as phlegm—and that an imbalance caused certain illnesses depending on which characters in this story were in excess or deficiency. Blood, diarrhea, and other body substances such as vomit all contain pathogenic bacteria.

The three main body fluids are what?

The three main bodily fluids in human body are bloodstream, tissue fluids, and lymph. They deliver nutrition and oxygen to numerous bodily areas and remove metabolic wastes that must be evacuated from the body.

To know more about body fluids visit:

https://brainly.com/question/13873557

#SPJ4

To identify the genotype of yellow-seeded pea plants as either homozygous dominant (YY) or heterozygous (Yy), you could do a test cross with plants of genotype _______.

Answers

You could perform a test cross with plants of genotype yy to see whether yellow-seeded pea plants are homozygous dominant (YY) or heterozygous (Yy).

YY is the genotype (homozygous recessive). The genotype of the heterozygous yellow-seeded plant will therefore be "Yy," whereas the genotype of the green-seeded plant will be "yy" (as the recessive allele is expressed only in homozygous conditions).

The genotypes (allele combinations) and phenotypes (observable traits) of progeny from genetic crossings can be predicted using a Punnett square. An organism with a dominant trait can be tested to see if it is homozygous or heterozygous using a test cross. The genotype of the parent will be homozygous dominant (TT) if the outcome is all tall plants.

Learn more about genotype Visit: brainly.com/question/902712

#SPJ4

the cytoskeleton of a eukaryotic cell plays a major role in organizing the structures and activities of the cell. the cytoskeleton consists of three main types of fibers: microfilaments, intermediate filaments, and microtubules. the three types of fiber differ in size, composition, and the functions they perform in the cell.1. In eukaryotic flagella, the fibers that slide past one another due to the activity of dynein proteins are _____2. Many cell organelles, most notably the nucleus, are anchored by which are assembled from a diverse class of proteins _____3. Centrosomes are sites where protein dimers assemble into _____4. The extension of pseudopodia in amoeba is due to the regulated assembly and destruction of _____5. The only cytoskeletal fibers not associated with intracellular movement or whole cell locomotion are the _____6. During muscle contractions, myosin motor proteins move across tracks of _____

Answers

Microtubules, intermediate filaments, 3. Microtubules, 4. Intermediate filaments, 5. Microfilaments 6. Microfilaments

What exactly is a cell?

The smallest building block of all living things, including human tissues. The membrane protein, the nucleus, and indeed the cytoplasm are the three major components of a cell. The cell membrane encloses the cell and regulates the chemicals that enter and exit the cell.

What are cells, and what do they do?

All living things are constructed mostly from cells. There are thousands of billion of cells throughout the human body. They give the body structure, absorb nutrients from meals, transform those calories into energy, and perform certain tasks.

To know more about Cells visit:

https://brainly.com/question/30046049

#SPJ4

The number 12.68 x 102, when expressed in correct scientific notation, becomes ________.
A) 1268 x 104
B) 0.1268 x 100
C) 1.268 x 103
D) 1.268 x 10-3

Answers

Technically 12.38 × 10^2 is in scientific notation ; any number expressed in the form a × 10^b is in scientific notation.

However, it is not in normalized scientific notation . In normalized scientific notation, there is exactly 1 non-zero digit to the left of the decimal point in the a term (with an exception being made for zero which in scientific notation is written as 0.0 × 10^1).

In normalized scientific notation, your original value would be written as

1.238 × 10^3

Learn more about Scientific notation here:

https://brainly.com/question/1767229

#SPJ4

32-year-old woman presents due to several days of vaginal itching & d/c. She also has pain with sexual intercourse. She denies fever, chills, abdominal pain, urinary frequency or dysuria. In the past years she has had 2 new male sexual partners. She takes OCP & uses condoms on most occasions. Patient denies any chronic medical conditions & denies prior surgeries. Denies any other medications. Her LMP was 3 weeks ago. Temp is 36.7C (98F) & BP: 100/60. Pelvic exam shows vulvar & vaginal erythema & a small amount of vaginal d/c with a pH of 4. Which of the following is the most causative organisms?A. Candida albicansB. Chlamydia trachomatisC. Gardnerella vaginalisD. Neisseria gonorrheaeE. Trichomonas vaginalis

Answers

Trichomonas vaginalis is the causative agent of vaginal erythema or vulvovaginitis.

The correct option is option E.

Trichomonas vaginalis is basically an anaerobic as well as a flagellated protozoan parasite which is the causative agent of a particular sexually transmitted disease which is known as trichomoniasis. It is basically the one of the most common pathogenic protozoan which happens to infect humans. The infection rates are similar in men as well as women but women are the ones who are mostly symptomatic whereas the infections in men are mostly asymptomatic.

Transmission basically occurs through a direct, skin-to-skin contact with a particular infected individual, which is most often through the vaginal intercourse. Risk factors consist of multiple sexual partners and also not using condoms during sexual intercourse. It causes a genital itching foul-smelling vaginal discharge, and painful urination in women.

To know more about Trichomonas vaginalis here

https://brainly.com/question/3129990

#SPJ4

Aquaporins are special water channels that allow the bulk transport of water across the hydrophobic plasma membrane. Which of the following is NOT true about them: A.mutations on genes associated with them can lead to certain medical conditions (e.g. diabetes, vision problems, etc.). B.plants use them to not only transport water, but help with metal detoxification. C.All are true. D.they are vital for kidney function in mammals. E.they require the use of ATP to function.

Answers

Option E is Correct. Special water channels called aquaporins enable the bulk movement of water across the hydrophobic plasma membrane.

They do not require the consumption of ATP in order to function, which is a false statement about them. The majority of known AQP2 gene mutations result in an erroneous 3-dimensional protein folding of the aquaporin 2 protein. The misfolded protein is entrapped inside the cell, preventing it from moving water molecules to the cell membrane.

Aquaporins efficiently speed up the total rate of water diffusion across the cell membrane due to the slow diffusion of water through the lipid bilayer. Aquaporins (AQP) are essential membrane proteins that act as conduits for the passage of water and, occasionally, tiny solutes.

Learn more about Aquaporins Visit: brainly.com/question/14810489

#SPJ4

Polychate external! Where are this located?|
- jaws
- pharynx
- palps
- cirri
- setae
- parapodia

Answers

The given organs in the Polychaete external are located from top to down as follows:

Jaws, Pharynx, Palp, Cirri, parapodia, and setae respectively.

What is Polychaete external?

Polychaete external may be characterized as a marine annelid worm that is commonly called bristle worm or polychaetes. Its body segment has a pair of fleshy protrusions called parapodia that bear many bristles, called chaetae, which are made of chitin.

The mouth of polychaetes is located on the peristomium, the segment behind the prostomium, and varies in form depending on their diets. They are multi-segmented worms living in all environments in the world's oceans.

They are present from abyssal depths to shallow estuaries and rocky shores, and even free-swimming in open water. They are strictly aquatic annelids but are the most abundant and diverse group of Phylum Annelida.

To learn more about Polychaeta, refer to the link:

https://brainly.com/question/9031768

#SPJ1

Interpret the model
(A DNA structure with a green thing in the middle and small red circles floating upwards)
Drag "True" or "False" to the end of each statement.
The blue ovals are hydrophobic. The strings of little red dots represent carbohydrates. The many black lines represent amino acid tails. The model is called a bilayer because there are two main types of molecules present, lipids and proteins. This model shows membrane transport. The blue ovals represent phospholipid heads.

Answers

The statement:

The blue ovals are hydrophobic is true.

The strings of little red dots represent carbohydrates is false

The many black lines represent amino acid tails is false

The model is called a bilayer because there are two main types of molecules present, lipids and proteins is true.

This model shows membrane transport is True.

The blue ovals represent phospholipid heads is true.

This model depicts a biological membrane, especially a bilayer. A bilayer is made up of two kinds of molecules: lipids and proteins. The blue ovals in the model are phospholipid heads, which are hydrophilic molecules that compose the outer layer of the membrane. The green molecule in the middle of the figure is encircled by little red circles, which represent carbohydrates. The many black lines indicate hydrogen bonding, which are crucial for the structure and stability of the membrane. This model depicts a membrane transport mechanism in which molecules travel from one side of the membrane to the other. Molecules travel across the membrane by passing through the phospholipid head or being carried by proteins anchored in the membrane. This model depicts how the structure of the bilayer and its constituents promote molecular transport across the membrane.

For more such questions on biological membrane, click on:

https://brainly.com/question/15232905

#SPJ4

All viruses are composed of a ____ made of ____ which surrounds the inner core containing ____ or RNA. Some viruses may also posses an external membranous covering that comes from the ___ ___. These viruses are know as ____, whereas viruses without this outer covering are called ____ viruses.

Answers

All viruses are composed of a capsid, made of proteins, which surrounds the inner core containing DNA, Some viruses may also posses an external membranous host cell, These viruses are enveloped viruses, this outer covering are called .non-enveloped viruses.

Capsid: This is a protein shell that surrounds and protects the genetic material of the virus. It is made up of many protein subunits called capsomeres.

Proteins: The capsid itself is made up of proteins, but there are also many other viral proteins that are involved in various stages of the viral life cycle, including entry into host cells, replication, and assembly of new viruses.

DNA or RNA: The genetic material of the virus can be either DNA or RNA, but not both. This genetic material contains all the information the virus needs to replicate and produce new viruses.

Host cell: Some viruses, such as the influenza virus, have an outer envelope that is derived from the host cell that they infect.

Enveloped viruses: These are viruses that possess an outer envelope derived from the host cell. Examples include the influenza virus, HIV, and herpes simplex virus.

Non-enveloped viruses: These are viruses that do not possess an outer envelope. Examples include the poliovirus, adenovirus, and norovirus.

Viruses are small infectious agents that consist of genetic material (DNA or RNA) surrounded by a protein coat called a capsid. Some viruses have an additional external layer called an envelope, which is made up of lipids and proteins and is derived from the host cell's membrane. Enveloped viruses are typically more susceptible to environmental factors such as heat, detergents, and disinfectants.

Non-enveloped viruses lack this outer layer and are generally more resistant to these factors. Understanding the structure of viruses is important for developing strategies to prevent or treat viral infections, as well as for developing vaccines that can trigger an immune response against specific viral proteins.

To learn more about virology and the structure of viruses, refer:

https://brainly.com/question/28544841

#SPJ4

In response to a muscle being stretched, a muscle spindle initiates a somatic spinal reflex that causes what?

Answers

Answer: Explanation:

A sudden stretch, such as tapping the Achilles' tendon, causes a reflex contraction in the muscle as the spindles sense the stretch and send an action potential to the motor neurons which then cause the muscle to contract; this particular reflex causes a contraction in the soleus-gastrocnemius group of muscles.

Help

Analyze the image below. The fossils in each of the layers shown in the image are found in many locations. These organisms lived for a short period of geologic time. To which classification do these fossils belong?
A) range fossils
B) microfossils
C) index fossils
D) ​trace fossils

Answers

Range fossils in each of the layers shown in the image are found in many locations.

What is fossil?

Fossils are the remains or signs of prehistoric life that have been preserved by the forces of nature. Shells, bones, exoskeletons, things preserved in amber, petrified wood, coal, hair, oil, and Genetic traces are a few examples of fossils. Another type of fossil is a skeletal structure.

What is Range fossils ?

The temporal interval between a fossil's first and last occurrences in the rock strata/sediment records serves as the best definition of a fossil range. We can infer when and how long specific species may have existed in the past by comprehending fossil ranges and being able to date rock strata.

Therefore, Range fossils in each of the layers shown in the image are found in many locations.

Learn more about fossils from the given link.

https://brainly.com/question/11829803

#SPJ1

2.
Chapter 7 Cell Structure and Function
Concept Map
Using information from the chapter, complete the concept map below. If there is
not enough room in the concept map to write your answers, write them on a
separate sheet of paper.
Ident
function
in
Photosynthesis
Cells
include
3.
functions
in
Support and
protection
eurargedic
Cells
include
fungi
Cells
6.
Organelles
So with
Nucleus
stores
Graphic Organizer
a nucleus
multicellular.
Animal
cells
function
in
Releasing
usable energy
for the cell
include
5.
function
in
Producing
proteins
Pearson Education, Inc. All rights reserved.
Teaching Resources/Chapter 7

Answers

The correct options to fill in the gaps are as follows:

2. chloroplasts function in photosynthesis.

3. cytoskeletons function in support and protection.

4. mitochondria function in releasing usable energy for the cell.

5. ribosomes function in producing proteins

6. nucleus - stores genetic information

What are cell organelles and their functions?

A cell organelle is a subcellular structure that, like an organ in the body, has one or more specific tasks to carry out within the cell.

Some cell organelles and their functions include:

The nucleus -  which houses genetic material,

the mitochondria - which generate chemical energy, and

the ribosomes - which put together proteins, are some of the more significant cell organelles.

Learn more about cell organelles at: https://brainly.com/question/6563752

#SPJ1

for an individual with this genotype: mmnnoopp, what proportion of their haploid gametes would have the following genotype: mnop?

Answers

An individual with the genotype mmnnoopp has two copies of each of four different alleles. During meiosis, this individual produces four haploid gametes, each carrying one allele from each of the four gene loci.

The probability of any particular gamete carrying the m, n, o, or p allele is 0.5, since the individual has two copies of each allele. The genotype mnop requires the presence of one copy of each of these four alleles.

Therefore, the probability of a gamete carrying the genotype mnop is 0.5 x 0.5 x 0.5 x 0.5 = 0.0625, or 6.25%. Thus, approximately 6.25% of the haploid gametes produced by an individual with the genotype mmnnoopp would have the genotype mnop.

To know more about  genotype, here

https://brainly.com/question/12116830

#SPJ4

Imagine two genes, C and D, that are unlinked. A diploid individual with genotype CD/cd makes gametes with no errors in meiosis. What percent of that individual's gametes are expected to be CD?
O 25O 24O 22O 26

Answers

If genes are unlinked, all four test cross offspring types, also with a and b/b, might equal 25%. In this case, making a mistake by adding the total number of dominating creatures first from two groups and utilizing that data to get the result.

How can the quantity of eggs and sperm that a genotype produces be calculated?

The method 2n, where n is the number of distinct variants represented in the genotype, can be used to determine how many eggs and sperm are generated by a particular genotype. One predominant genotype, Ab, and two discrete alleles, Bb and Cc, make up the polymorphism in this case.

What does it mean when it says "two genes are related" in relation to meiosis?

Genes are referred to as related if they share a chromosome. Unless they are separated by crossing over, the alleles for these genes usually remain together throughout meiosis. During meiosis, sibling dna strands exchange genetic material in a process known as crossing over.

To know more about  predominantVisit:

https://brainly.com/question/13278945

#SPJ4

explain how the epithelium in each of the following regions of the respiratory tract is adapted so its structure follows its function

Answers

Epithelial cells that have ciliated surface features line the upper portion of the respiratory tract. Toxins, particulate materials, and microbes that enter the airway are assisted by cilia in their capturing, sweeping, and expulsion.

What kind of epithelium lining the respiratory tract is there?

Six different cell types make up the pseudostratified ciliated epithelium that makes up the respiratory epithelium. 90% of the cells population is made up of three of these: basal cells, ciliated cells, and goblet cells.

What is the airway epithelium's structure?

In the large airways, the airways epithelium is pseudostratified, while in the tiny airways, it becomes columnar and cuboidal. Ciliated, columnar, undifferentiated, secretory, and basal cells are the main cell types.

To know more about microbes visit:

https://brainly.com/question/14571536

#SPJ4

cladistics help to organize organisms based on shared homologous characteristics. which of the following is considered false when looking at a cladogram? responses

Answers

A method other than infected persons from parent(s) to child for transferring genetic material by one species to another.

In biology, what exactly is a homologous?

Possessing the same conventional arrangement and position. In biology, the term "homologous" can refer to two different anatomical features or behavioral characteristics that developed from a component or characteristic of their shared ancestor organism.

In anatomy, what does the term homologous mean?

Identical anatomical traits in an organism's body parts, known as homologous structures, point to a shared evolutionary progenitor or developmental origin. Despite the fact that they could have a similar attribute, their functions are not always the same. Humans and bats both have homologous anatomy for their forelimbs, for instance.

To know more about Homologous visit:

https://brainly.com/question/28943419

#SPJ4

FILL IN THE BLANK. an onion is an example of a _____, an underground stem surrounded by leaves also modified for storage. question 10 options: tuber rhizome cladophyll bulb

Answers

An example of a bulb is an onion, which is a modified underground stem surrounded by leaves for storage.

A type of modified stem is a bulb. These short, mostly fleshy, leaf-like stems serve as food storage by being made of stems.

An underground stem known as a bulb contains roots on the lower side of the fleshy leaf that develops into a new plant. Example: Lily and the onion (Allium cepa) (Lilium bulbifera).

Like in ginger and turmeric, rhizomes are modified stems that grow horizontally at a specific depth and can store food.

As in colocasia and saffron, a corm is an underground adaptation of a stem made for storage.

A modified stem known as a tuber swells up from the buildup of starch and protein, much like a potato.

So "Bulb" is the appropriate response.

Learn more about "Bulb" visit here;

https://brainly.com/question/26254699

#SPJ4

right before fertilization occurs, cells are still at this stage. select the best answer from the following choices select answer select the best answer from the following choices

Answers

Right before fertilization occurs, cells are still at this stage : 1.) haploid cell in this stage is called secondary oocyte.  

 

What are the stages of fertilization?

Stages of fertilization are made up of four mechanisms: Prior to sperm-egg fusion, sperm preparation, sperm-egg binding, fusion of the pronuclei of the sperm and egg and zygote activation all takes place.

During fertilization, sperm and egg join to form zygote in one of the fallopian tubes. Zygote then develops into morula after passing through  fallopian tube. Morula grows into blastocyst once it enters uterus. Blastocyst then goes through implantation, during which it penetrates the uterine lining.

To know  more about fertilization,

https://brainly.com/question/1294562

#SPJ4

Note: The question given on the portal is incomplete. Here is the complete question.

Question: Right before fertilization occurs, cells are still at this stage.

select the best answer from the following choices:

1. haploid a cell in this stage is called a secondary oocyte.  

2. haploid these cells are the mitotic products of germ cells.

3. diploid cells contain 2n

colonomics - predictive models for normal colon gene expression and dna methylation for twas and mwas.T/F

Answers

The statement about colonomics - predictive models for normal colon gene expression and DNA methylation for TWAS and MWAS is true.

Thus, the correct answer is true.

What is colonomics?

Colonomics is а multi-omics dаtаset thаt includes 250 sаmples: 50 sаmples from heаlthy colon mucosа donors аnd 100 pаired sаmples from colon cаncer pаtients (tumor/аdjаcent). From these sаmples, Colonomics project includes dаtа from genotyping, DNА methylаtion, gene expression, whole exome sequencing аnd micro-RNАs (miRNАs) expression.

The genetic prediction models represent reference imputаtion pаnels for normаl colon tissue methylаtion аnd gene аnd miRNА expression, which аre of high interest for performing TWАS studies for colon-relаted diseаses.

For more information about DNA methylation refers to the link: https://brainly.com/question/6612810

#SPJ4

he piece of DNA written below was found by an undergraduate researcher while examining a novel bacteria strain. Show the undergraduate researcher what the doublestranded DNA would look like for this single strand of DNA. Make sure you show all important chemical components that describe DNA orientation.
5 ′

GGCGAATCATGCGCTGCCTTGTTTCCACTAGTAGACGCGGGACTTGGTTTCACACATGACGCGT

Answers

Deoxyribose and phosphate groups alternately form the backbone of each strand. One of the four bases—adenine (A), cytosine (C), guanine (G), or thymine—is joined to each sugar (T).

How many hydrogen bonds, in comparison to C and G, can A and T form?

Adenine and Thymine are joined by two hydrogen bonds, but Guanine and Cytosine are joined by three hydrogen bonds.

What kind of bonds make up the double helix?

A hydrogen bond between the G-C and A-T base pairs holds the two complementary strands of nucleotides that make up each DNA molecule's double helix together. One DNA strand serves as a template for the creation of a complementary strand, which results in the duplication of the genetic code.

to know more about DNA here:

brainly.com/question/264225

#SPJ4

Other Questions
A families dishwasher uses the same number of gallons of water for each load the table shows how many gallons of water G the dishwasher uses for in loads of dishes what equation can you use to represent the relationship shown in the table show York Please help me unscramble these !!! will mark as brainliest :) Determine whether the following arguments are best interpreted as being inductive or deductive. Also state the criteria you use in reaching your decision (i.e., the presence of indicator words, the nature of the inferential link between premises and conclusion, or the character or form of argumentation).Contrary to the common notion that women tend to be chatty compared to men, little difference exists between the sexes in terms of talkativeness. Over a five-year period researchers placed unobtrusive microphones on 396 college students in various fields, at campuses in Mexico as well as in the United States. They found that both men and women spoke about 16,000 words per day. Compute the magnitude and phase spectra of the following signals (i.e. compute the Fourier coefficients and determine the magnitude and phase of each one of them). a. a[n] = 4 sin(in/3) b. x[n] = cos(2n7/3) + sin(2n7/5) c. x[n] = cos(2n7/3) sin(2n/5) (a trig. identity that might be useful: cos(x) sin(y) = 1/2 (sin(x + y) sin(x y)) The radius of a circle is 21 m. Find its area to the nearest whole number. traditional clothing worn by the sami crossword clue PLEASE HELPPPP I DONT UNDERSTAND ITTT When an ethical climate exists at a firm, studies suggesta. people are less likely to want to leave the firm.b. people are likely to only perform the duties of their job description because they do not want to engage in anything that will upset the balance of the ethical situation in place.c. people are not as satisfied with their jobs.d. people are less committed to the firm. identify the types and features of common network services. Cross-stitch is a kind of art. The area where the art is made is a grid of little squares. The artist makes a cross-stitch pattern bysewing small crosses in some squares while leaving other squares blank.Carlita just finished her very first piece of cross-stitching. It is shown below.HOMECarlita called her best friend, Susan, to tell her about it. Susan wants to make a cross-stitch just like Carlita's, so she asks for apicture of it. The camera on Carlita's phone is broken.How can Carlita tell Susan which squares should have crosses on them quickly, exactly, and clearly?OA. Carlita could describe to Susan the color that she used and how to make a well-shaped cross.OB. Carlita could tell Susan what the cross-stitch says and how much thread she used.OC. Carlita could send Susan a text message that tells her what supplies were used and how much they cost.OD. Carlita could e-mail Susan a long number for each row with zeroes for blanks and ones for crosses. PLEASE HELP!!!!!!which equation can be used to solve for x?A) 135x = 180B) 9x + 126 = 90C) 9y = 126D) 9x + 126 = 180PLEASE LOOK AT PICTURE!!!! 2) using the following exhibit from the textbook, explain how the u.s. can gain in trade even though it has an absolute advantage in both shoes and refrigerators. (your answer should include whether more product is available via specialization.) how long does breast milk last after being warmed up what is the meaning of "beneatha from raisin in the sun"? What are the 3 main cognitive theorists? Question 3(Multiple Choice Worth 2 points)(05.01 MC)Read the following stanza from a poem by James Whitcomb Riley and answer the question that follows."The Days Gone By"O the days gone by! O the days gone by!The apples in the orchard, and the pathway through the rye;The chirrup of the robin, and the whistle of the quailAs he piped across the meadows sweet as any nightingale;When the bloom was on the clover, and the blue was in the sky,And my happy heart brimmed over in the days gone by.Which figurative language device is present in the bolded words?O AllusionO IdiomO MeiosisO Onomatopoeia occams razor states that Which of the following statements is true about black military service during the Civil War?Black soldiers were paid less because whites thought they would only be used for menial work. When blood leaks out of the vein around the puncture site during venipuncture and collects under the skin, it forms a(n) ________. Firms that want to start getting into a global market with the least amount of investment possible will most likely begin with ________.