What are the 3 factors that cause natural selection?

Answers

Answer 1

Natural selection is founded on three principles: most qualities are inherited inheritance, more children are born than can survive competition, and children with more desirable characteristics will survive and produce more offspring variation.

One of the four fundamental tenets of evolutionary theory, along with mutation, migration, and genetic drift, is natural selection. Populations that exhibit variety in features, such as colour, are subject to natural selection. Its core tenet is that individuals are more likely to reproduce when they possess a characteristic that makes them more likely to survive in a given environment than their counterparts. Four requirements must be met for natural selection to take place: reproduction, inheritance, variety in physical traits, and variation in the number of children produced by each person.

To learn more about reproduction please visit here:

https://brainly.com/question/7464705

#SPJ4


Related Questions

The air and nutrients that are added to the fermenter are sterile. State why they must be sterile.​

Answers

The air and nutrients that are added to the fermenter must be sterile in order to prevent contamination from pathogens or other microorganisms that could disrupt the fermentation process.

What is fermentation?

Fermentation is a metabolic process during which organic molecules such as glucose are converted into energy-containing molecules such as ethanol, carbon dioxide, and/or organic acids. This process is often used in the production of beer, wine, and other alcoholic beverages, as well as in food production, such as the production of yogurt, cheese, and other fermented dairy products.

Contamination can lead to off-flavors, off-odors, and other undesirable qualities in the end product. Additionally, it may cause the fermentation process to be less efficient, leading to longer fermentation times or even a complete failure.

To know more about fermentation,

https://brainly.com/question/11554005

#SPJ1

Which of the following is the most accurate description of the methodological advantage of twin studies: . Twin studies use both self-report and peer report.
B. Because twins share DNA it is possible to estimate the contribution of genetics to their personality and behavior.
C. Because twins share genetics and live in the same environment they provide information about both nature and nurture.
D. Because there are two participants the findings always replicate.

Answers

Twin studies involve identical or fraternal twins. They aim to demonstrate environmental and genetic influences on traits, phenotypes, and disorders therefore, option b is the right choice.

Behavioral genetics, biology, and psychology use twin research. Behavior genetics uses siblings, adoption, pedigree, and twin studies to study genetics. These studies have tracked everything from personality to schizophrenia symptoms.

"Identical" or monozygotic twins share essentially 100% of their genes, so most differences between them (such as height, susceptibility to boredom, intelligence, depression, etc.) are due to experiences one twin has but not the other.

Like siblings, "fraternal" or dizygotic twins share 50% of their genes. Twins share their uterine environment, parenting style, education, wealth, culture, and community because they are born into the same family. Discordance—the presence of a genetic or phenotypic trait in only one twin—provides a powerful window into environmental effects on such traits.

Want to know more about Twin studies visit the link which is given below;

https://brainly.com/question/22078462

#SPJ4

Is a silent mutation missense?

Answers

A silent mutation occurs when a mutation is not changing any amino acid coded for that codon. so, they are also known as missense mutation.

In general, Nucleotide substitutions may lead to no change in the protein sequence which known as silent mutations. so , we can say that a silent mutation is a mutation that occurs within the DNA sequence, but they do not alter the amino acid sequence. These mutations takes place in an introns, that is spliced before translation.

Hence,  example may include Single nucleotide substitutions they are not involved in changing any of the amino acid sequence so termed as silent  polymorphisms. Mutation in these base pair will also not change the function of the protein.

To learn more about Silent mutations , here

brainly.com/question/9598940

#SPJ4

In hookworm cases where progressive anemia is present, what additional test procedure should be performed to determine infection in stool specimens

Answers

In hookworm cases where progressive anemia is present, the additional test procedure that should be performed to determine infection in stool specimens is the concentration technique.

Hookworms аre nemаtode pаrаsites thаt usuаlly get trаnsmitted through infested soil. They usuаlly аffect the poorest individuаls in tropicаl аnd subtropicаl аreаs. Two species аre mаinly responsible for humаn infections, Аncylostomа duodenаle аnd Necаtor аmericаnus. They cаn cаuse chronic infection of the intestinаl trаct, and suck their host blood, leаding to iron deficiency аnemiа in most cаses. Moreover, pulmonаry mаnifestаtions might occur by the effect of lаrvаl migrаtion.

The stаndаrd method for diаgnosing the presence of hookworm is by identifying hookworm eggs in а stool sаmple using а microscope. Becаuse eggs mаy be difficult to find in light infections, а concentrаtion procedure is recommended.

For more information about hookworm refers to the link:  https://brainly.com/question/13022071

#SPJ4

What is the best way to ensure proper protein levels?

Answers

To ensure proper protein level one should include various sources of protein that can include lean meat , eggs , diary products ,protein shakes and legumes .

Protein is one of the most essential nutrients for daily life , as they are required to help your body repair cells and make new ones. Protein also plays crucial role in growth and development in children and expecting mothers .

In general , proteins are required for the repairing and building your body's tissues, They also allows metabolic reactions to occurs at place for easy body function . so we can say that protein is crucial for maintaining structural framework of body and also helps in maintaining fluid balance .

To learn more about Protein , here

brainly.com/question/29776206

#SPJ4

or
Scientists theorize that all life started with simple prokaryotic organisms. New species continue to evolve
from existing species, creating the variety of life we see today. The following diagram shows the basic
process.
fungi
(oukaryotic,
unicellular,
multicellular)
protista
(eukaryotic,
uni-or
multicellular)
eubacteria
(prokaryotic,
unicellular)
animalia
(eukaryotic
multicellular)
universal
ancestor
plantae
(eukaryotic
multicellular)
archaebacteria
(prokaryotic,
unicellular)
Based on this diagram, do you think that organisms of the same order will share a stronger evolutionary
relationship than organisms that share only the same phylum? Explain your reasoning using the results of
your investigation.

Answers

The evolutionary relationship is stronger the more similarity. The taxonomical hierarchy's lower levels show more similarity. Thus, the organisms of the same species exhibit the greatest degree of similarity.

What is taxonomical hierarchy's?

Taxonomic hierarchy is an organizational structure used to classify or categorize living organisms.

Of course, organisms that belong to the same order will have a closer evolutionary bond than those that belong to the same phylum alone. Taxonomy groups organisms in various ways, as we all are aware. Kingdoms are the highest level of classification, followed by phyla, classes, orders, families, and species. The similarities between organisms will become more specific with each succeeding unit. In other words, when organisms are further subclassified, they share similar traits.
The order of organisms belonging to the same phylum is not required. The class, phylum, and kingdom of any two organisms from the same order, however, will always be the same.
For instance, the cockroach order Blattodea and the human order Primates. These two belong to the phylum chordata. But we are aware of the differences between cockroaches and people.
However, another member of the primate order, such as the monkey and the chimpanzee, have stronger evolutionary ties to humans and share more traits with them.
Therefore, the evolutionary relationship is stronger the more similarity. The taxonomical hierarchy's lower levels show more similarity. Thus, the organisms of the same species exhibit the greatest degree of similarity.

To learn more about taxonomical hierarchy's
https://brainly.com/question/1304906
#SPJ1

Explain how the result show that both light and chlorophyll must be present for photosynthesis.

Answers

Chlorophyll absorbs energy from blue and red light waves during photosynthesis while reflecting green light waves, giving the appearance of a green plant.

Chlorophyll, a light-absorbing pigment found in the thylakoid membranes of the chloroplast, is what gives plants their green hue. Chloroplasts, which are tiny organelles found inside plant cells, are there to store solar energy.  Despite the fact that there are numerous steps involved in photosynthesis, there are primarily two stages: light-dependent reactions and light-independent reactions. The light-dependent reaction, as its name implies, occurs inside the thylakoid membrane and necessitates a constant supply of sunshine. The light waves' energy is captured by the chlorophyll and transformed into chemical energy in the form of the molecules ATP and NADPH.

The Calvin Cycle's light-independent stage, which takes place in the stroma, or region between the chloroplast and thylakoid membranes, does not require light, hence the name light-independent reaction. In this phase, carbon dioxide is converted into carbohydrates like glucose using energy from the ATP and NADPH molecules. However, not all types of photosynthesis are made equal. C3 photosynthesis and C4 photosynthesis are two of the various forms of photosynthesis. The majority of plants engage in C3 photosynthesis. It entails the Calvin Cycle producing 3-phosphoglyceric acid, a three-carbon molecule that later transforms into glucose.

To know more about chlorophyll on

https://brainly.com/question/14580685

2. How does sneezing protect us from germs?​

Answers

Well if you sneeze your blowing out now sucking in

If R is dominant to r, the offspring of the cross of RR with rr will: a. have the same phenotype as the RR parent. b. have the same phenotype as the rr parent. c. have the same genotype as the RR parent. d. be homozygous.

Answers

As a result, the progeny will still have the homozygous gene rr. As a result, the offspring will share both parents' genetics and phenotypic.

What does genotype imply in its entirety?

The term "genotype" broadly refers to an organism's genetic make-up; in other words, this characterizes an organism's whole gene pool. The phrase can also be used to refer to a gene's alleles, or variant forms, in a more specific meaning.

Is the genotype AA typical?

Typically, there are five (5) distinct blood genotype kinds. AA, AS, Ad, SS, & SC are their names. While the first pairs (AA and or AS) are typical, AC is uncommon, and the last two (SS, SC) are atypical and irregular, frequently resulting in sickle cell disease.

To know more about genotype visit

brainly.com/question/29156144

#SPJ4

Which skin-color-associated, pigment-producing cell is located in the labeled layer D?
Section of the epidermis indicating epithelial layers and cell types.
O Merkel cell
O melanocyte
O keratinocyte
O fibroblast

Answers

Answer:

The correct answer is Melanocyte.

Explanation:

Took the test:)

Cobalamin, more commonly called vitamin B12, ______________________________. Question 50 options: is found abundantly in plant foods. when taken as a supplement, will increase metabolic functions, such as endurance performance. was one of the first parts of the B complex group to be discovered. is essential int he synthesis of DNA and in the development of red blood cells.

Answers

Cobalamin, or vitamin B12, is a water-soluble vitamin that is essential for human health. It is found abundantly in animal-derived foods, such as fish, meat, poultry, eggs, and dairy products, but it is not found in plant-based foods.

It is one of the first vitamins to be discovered and is part of the B-complex group of vitamins. Vitamin B12 plays a vital role in the synthesis of DNA, red blood cell development, and metabolic functions, such as endurance performance. When taken as a supplement, it can help to increase metabolic functions, such as endurance performance. It is also important for maintaining healthy nerve cells, as well as a healthy immune system.

Vitamin B12 deficiency can lead to anemia, fatigue, and cognitive decline. Therefore, it is important to ensure adequate intake of this essential vitamin, either through dietary sources or supplements. It is important to note that vitamin B12 is only found in animal-derived foods, so vegans and vegetarians should consider taking a vitamin B12 supplement to avoid deficiency.

To learn more about Vitamin B12 visit:

https://brainly.com/question/28214348

#SPJ4

What are the 3 events in meiosis that contribute to genetic variation ?

Answers

Crossing over, Independent assortment, and Random fertilization are the three meiotic events that affect genetic variation.

Crossing over: A process known as crossing over occurs when homologous chromosomes couple up and exchange genetic material during prophase I. Genetic variety is the outcome of this, which causes the development of chromosomes with novel gene combinations.

Independent assortment: The chromosomes arrange at random along the cell equator during metaphase I. This indicates that there is an equal likelihood for each pair of homologous chromosomes to be found in either daughter cell. Genetic variety results from the varied chromosomal arrangements in each daughter cell as a result.

Random fertilization: During fertilization, sperm and egg cells combine to form a zygote. Since sperm and egg cells are produced through meiosis, each one carries a unique combination of chromosomes.

To learn more about genetic variation

https://brainly.com/question/848479

#SPJ4

In cardiac muscle, the fast depolarization phase of the action potential is the result of
A) decreased membrane permeability to calcium ions.
B) increased membrane permeability to chloride ions.
C) increased membrane permeability to potassium ions.
D) decreased membrane permeability to sodium ions.
E) increased membrane permeability to sodium ions.

Answers

E) The increased membrane permeability to sodium ions causes the fast depolarization phase of the action potential in cardiac muscle.

In cardiac muscle cells, what causes the action potential's rapid depolarization phase?

An opening of fast sodium channels initiates the depolarization phase of the action potential in muscle and nerve cells. This also occurs in cardiac cells that do not have pacing devices; However, the initial depolarization phase of the action potential is influenced by calcium ions in cardiac pacemaker cells.

What takes place during cardiac muscle depolarization?

An electrocardiogram (EKG) is an indirect indicator of heart muscle contraction because contraction of the heart muscles is caused by depolarization of the heart. Without any external stimulus, the heart's cells will depolarize. Automaticity, or autorhythmicity, is the name given to this property of cardiac muscle tissue.

To learn more about depolarization phase here:

https://brainly.com/question/7340032

#SPJ1

Can cyanide cause permanent damage?

Answers

Answer:

it can cause damage to the Brian and heart.

Explanation:

Reduction of fluid losses at the kidneys due to the retention of Na+ is the action of
A) antidiuretic hormone.
B) calcitonin.
C) aldosterone.
D) cortisone.
E) oxytocin.

Answers

Reduction of fluid losses at the kidneys due to the retention of Na+ is the action of a hormone called aldosterone. So option c is correct.

Aldosterone is a steroid hormone produced by the adrenal glands that plays a crucial role in regulating electrolyte balance in the body.Aldosterone works by stimulating the kidneys to reabsorb more sodium ions (Na+) and water, and to excrete more potassium ions (K+). This results in an increase in blood volume and blood pressure, as well as a decrease in urine output.

By retaining more sodium ions, aldosterone helps to maintain the body's fluid balance and prevent dehydration.Aldosterone secretion is regulated by the renin-angiotensin-aldosterone system (RAAS), which is a complex feedback mechanism that responds to changes in blood pressure and electrolyte levels. When blood pressure drops or when the body loses too much sodium, the kidneys secrete the enzyme renin, which converts angiotensinogen to angiotensin I. Angiotensin I is then converted to angiotensin II by the enzyme ACE, which stimulates the release of aldosterone.

Learn more about aldosterone at : https://brainly.com/question/28303131

#SPJ4

Which of the following general mechanisms appear to be involved in the formation of cancer cells?
A) Genomic instability, DNA repair failure, chromatin modifications.
B) Inversions, operon formation, methylation.
C) RNA failure, DNA phosphorylation, phosphorylation of adenyl cyclase.
D) Transdetermination, mutation, allosteric interactions.
E) Suppression, tabulation, projection.

Answers

Cancer is brought on by cells that divide out of control and invade surrounding tissues. Cancer is mostly brought on by DNA changes. The majority of DNA mutations that result in cancer occur in areas of DNA called genes.

What precisely does DNA mean?

DNA, commonly referred to as deoxyribonucleic acid, is the genetic material carried by humans and nearly everything else organisms. A person's DNA is present in almost all of their cells.

What does DNA do and what is it?

DNA is the molecule of information. It provides the knowledge required to produce proteins, another type of substantial molecule. Each of your cells contains 46 substantial objects set of chromosomes that are distributed throughout these instructions. These chromosomes are made up of numerous smaller segments of DNA, called genes.

To know more about DNA visit:

brainly.com/question/264225

#SPJ4

The same basic internal organs (kidneys, stomach, heart, and lungs) are found in frogs, birds, snakes, and rodents. This is primarily an example of ________.Group of answer choicesinheritance of acquired characteristicsstructural homologydevelopmental homology

Answers

The same basic internal organs (kidneys, stomach, heart, and lungs) are found in frogs, birds, snakes, and rodents. This is primarily an example of structural homology

The phrase "survival of the fittest" refers to the process of natural selection, a mechanism that promotes evolutionary development. Natural selection works by favoring individuals who are more suited to a particular set of environmental conditions over those who are not.

Because it brings new variety into the population, mutation is the only method of evolution identified that increases the quantity of genetic variation. Genetic drift is the loss of genetic variation caused by chance over time.

Learn more about to organs

https://brainly.com/question/12825206

#SPJ4

In a transformation experiment, a sample of E. coli bacteria was mixed with a plasmid containing the gene for resistance to the antibiotic ampicillin (ampr). Plasmid was not added to the second sample. Samples were plated on nutrient agar plates, some of which were supplemented with the antibiotic ampicillin. The results of E. coli growth are summarized below. The shaded area represents extensive growth of bacteria; dots represent individual colonies of bacteria. Plates that have only ampicillin resistant bacteria include which of the following?
a. I only
b. III only
c. IV only
d. I and II

Answers

Option A, The plasmid containing the amp gene was added to the first sample of E. coli, but not to the second sample. Therefore, only the first sample should contain bacteria that are resistant to ampicillin.

This is represented by the shaded area on the plate I, which indicates extensive growth of bacteria. Plates II, III, and IV do not have any shaded area, meaning that there is no extensive growth, and only dots representing individual colonies of bacteria.

Since the plasmid was not added to the second sample it does not have resistance to the antibiotic. This means that plates III and IV, which contain the antibiotic, will not have any ampicillin-resistant bacteria and thus the answer is a. I only.

To learn more about E. coli bacteria at

https://brainly.com/question/18722309?referrer=searchResults

#SPJ4

In the digestive system many large molecules, such as proteins, are broken down into much smaller molecules. State what happens to these smaller molecules following digestion.

Answers

Smaller molecules are taken up into the bloodstream by epithelial cells that line the walls of the small intestine. The waste continues to the colon where water is absorbed and the dried waste is compacted into feces. It is stored until excreted from the anus through the digestive system

The digestive system breaks down the food we eat into its simplest forms: glucose (sugar), amino acids (which make up protein), and fatty acids (which make up fat). Absorbed by the flow, the nutrients are carried to every cell in the body.

The human digestive system consists of the gastrointestinal tract and the accessory digestive organs. Digestion breaks down food into smaller and smaller components until they are absorbed and absorbed by the body.

For more information on digestive system  , visit :

https://brainly.com/question/29485648

#SPJ4

State a reason why the water lily lacks a waxy cuticle.

Answers

WATER LILY

One reason why the water lily (Nymphaea spp.) lacks a waxy cuticle is because it is adapted to living in an aquatic environment. A waxy cuticle is a layer of cutin, a waterproof, protective coating found on the surface of plant leaves and stems. It helps to prevent water loss through evaporation and protect the plant from dehydration.

However, water lilies are adapted to living in an aquatic environment, where they are constantly surrounded by water. As a result, they do not need to worry about water loss through evaporation and do not have a waxy cuticle to prevent it. Instead, water lilies have evolved other mechanisms, such as thick, succulent leaves and stems, to help them absorb and store water.

Hope This Helps You!

The water lily lacks a waxy cuticle because it is generally present in the water, so it does not have the adaptation to save water, so it does not have the waxy cuticle, while these are the adaptations of the desert plants.

What is the significance of the water lily?

The water lily is significant as it has an important role in aquatic ecosystems because it provides food for a wide variety of aquatic animals, such as insects and fish, while its roots can help stabilize shorelines, prevent erosion, and purify water by removing excess nutrients. Its seeds are of great interest to humans due to their high demands.

Hence, the water lily lacks a waxy cuticle because it is generally present in the water, so it does not have the adaptation to save water, so it does not have the waxy cuticle, while these are the adaptations of the desert plants.

Learn more about the water lily here.

https://brainly.com/question/29803241

#SPJ2

Cell volume (and therefore cell function) in most cells is dependent upon careful regulation of
A) permeability of cell membranes.
B) blood pressure.
C) volume of extracellular fluid.
D) resting membrane potential.
E) osmolarity of extracellular fluid.

Answers

In most cells, careful management of cell volume (and hence cell function)

How do cells form?

Through a process known as the cell cycle, new cells are generated from existing cells. A cell has the ability to duplicate itself and give rise to two additional daughter cells. Every cell cycle requires the performance of two key functions. Cells must first create a perfect replica of their DNA. membrane potential during rest.

Where do cells develop?

Depending on the area of the body, it can take a cell from the moment it is formed in the base layer of skin until it is lost from the surface for around a month.

To know more about  cells visit:

https://brainly.com/question/30046049

#SPJ1

In most cells, careful management of cell volume (and hence cell function)

How do cells form?

Through a process known as the cell cycle, new cells are generated from existing cells. A cell has the ability to duplicate itself and give rise to two additional daughter cells. Every cell cycle requires the performance of two key functions. Cells must first create a perfect replica of their DNA. membrane potential during rest.

Where do cells develop?

Depending on the area of the body, it can take a cell from the moment it is formed in the base layer of skin until it is lost from the surface for around a month.

To know more about  cells visit:

brainly.com/question/30046049

#SPJ4

A prey population consists of individuals with a variety of reaction times. The adaptation that allows some of these animals to react faster would be an example of natural selection if it helps them a. Reduce the mortality rate of the population

b. Reproduce and increase gene frequency in the population

c. Survive and mate

d. Produce offspring that can react at an average speed

Answers

The correct answer is option (A) Reduce the mortality rate of the population.

Natural selection is a pressure that causes groups of organisms to change over time. Animals inherit their genetics from their parents or ancestors, and the environment is constantly changing. So, no organism is perfectly adapted to its environment. Thus, natural selection is constantly influencing the evolution of species.

The environment will change, even if a parent was perfectly acclimated to it, leaving the offspring poorly adapted to it. Only the best and fittest organisms can reproduce since there are many species and few resources. Natural selection, which is thought of as the environment and forces acting to prevent organisms from surviving and reproducing, operates against all living things. As a result, living things have the ability to pass on their DNA to the next generation. These DNA sequences are "selected" for by this.

To learn more about Natural selection please visit here:

https://brainly.com/question/2725702

#SPJ4

A cement factory emits 900 kilograms of CO2 to produce 1,000 kilograms of cement. A fully grown tree removes six kilograms of CO2 per day from the air. One acre of land can support 200 mature trees.
A company builds a factory that will produce 100,000 kilograms of cement. To make the factory carbon neutral, the owners need to grow
15000
trees over an area of land measuring
acres.

Answers

The land area in acres that can support 15000 trees is 75 acres.

What area of land can support 15000 trees?

The land area in acres that can support 15000 trees is calculated as follows:

mass of CO₂ emitted by a cement factory emits to produce 1,000 kilograms of cement = 900 kilograms of CO₂

A fully grown tree removes six kilograms of CO2 per day from the air.

One acre of land can support 200 mature trees.

Since the owners need to grow 15000 trees, the area of land required will be:

The area of land required = 15000 trees * 1 acre / 200 trees

The area of land required = 75 acres

Learn more about acres at: https://brainly.com/question/28442124

#SPJ1

A student illustrates a process of cell division by creating a series of models, as shown here. Which description should the student include with the model to make it more informative and accurate?

Answers

The process of cell division is an ordered series of events involving cell growth and that produces two new daughter cells.

What stage or phase of the cell cycle does the chromosomal alignment in the centre of the cell relate to?

All of the chromosomes are aligned in the metaphase plate, also known as the equatorial plane, which is situated halfway between the cell's two poles.

What distinguishes meiosis from mitosis?

For somatic cells and the asexual reproduction of unicellular eukaryotic cells, mitosis is a type of cell division. The form of cell division known as meiosis is used to produce gametes during sexual reproduction.

A non-dividing cell is characteristic of which stage of the cell cycle?

The interphase, which can be divided into two stages: the first gap (G1) between the final mitosis and the DNA-synthesising S phase and the second gap (G2) between the end of the S phase and the subsequent mitosis, is the time when the cell is not actively dividing (M).

Learn more about cell cycle here:

brainly.com/question/25282664

#SPJ1

What claim can you make about whether any of the individuals in one population have arm lengths similar to the individuals in the other population?

Subject is UCSD vs Laguna Mt juncos

Answers

Due of the larger range in the blue population's largest tower's height than in the yellow population.

They don't have to worry about the planet providing for them because they have a stable climate, which allows them to have children virtually all year round, and human-provided resources. Your traits, which are features or characteristics that you inherit from your parents, are determined by the information carried by your genes (say: trates). In the human body, each cell has between 25,000 and 35,000 genes. A common garden experiment reveals that individuals in the UCSD population had shorter wings and tails than those in the adjacent mountains, and the physical variations are genetically based.

Learn more about genes here-

https://brainly.com/question/8832859

#SPJ4

Is an irony on the discrepancy between the expected result and actual result?

Answers

Yes, the irony is the discrepancy between the expected result and the actual result.

The presence of a contradiction between what is stated and what is meant is the foundation for the growth of irony.

Irony can be broken down into three categories:

1. A piece of writing has linguistic irony if the author says one thing but really means something else.

2. The term "dramatic irony" refers to a situation in which the audience is aware of something or learns to realize something that a character in the literature is unaware of.

3. A scenario might be said to have dramatic irony when there is a discrepancy between the expected result and the actual results.

You can also learn about dramatic irony from the following question:

https://brainly.com/question/1399387

#SPJ4

what can temperature and pH measurements tell you about the biogeochemical cycles in a pond ecosystem

Answers

The most important climatic element affecting soil N and P cycles is temperature. Temperature increases often aid in the breakdown of soil organic matter and the buildup of soil accessible nutrients.

They are essential because they recycle and store materials, as well as control key elements through physical features. These cycles represent the interaction of living and non-living entities in ecosystems and allow ecosystems to survive indefinitely.

Biogeochemical cycles change the chemistry of the ocean, atmosphere, and terrestrial ecosystems across geological time, so that rate-limiting reactions within important cycles change the speed and manner of development.

Learn more about to Biogeochemical

https://brainly.com/question/1204069

#SPJ4

Which of the following statements about human impact on trees is true?
a.Human activity always has a negative impact on trees.
b.All human uses of trees require destruction of the trees.
c.Human activity has had both a positive and negative impact on trees.
d.Cutting down trees is the only activity that has a negative impact on trees.

Answers

Answer:

c. Human activity has had both a positive and negative impact on trees.

Human activity can have negative impacts on trees, such as deforestation and clearcutting, but it can also have positive impacts, such as tree planting and reforestation efforts. It is not true that all human uses of trees require destruction of the trees, as humans also use trees for a variety of non-destructive purposes such as recreation, wildlife habitat, carbon sequestration, and aesthetic value. And cutting down trees is not the only activity that has a negative impact on trees, other human activities such as air pollution, soil degradation, water pollution can also have negative impacts on trees.

A scientist is observing an invertebrate animal that she collected in shallow salt water. The animal has a hollow central cavity and a gut.Which animal is the scientist most likely observing

Answers

Answer: a cnidarian, because it has a gut a cnidarian, because it was collected in shallow salt water a sponge, because it has tissue layers a sponge, because it is an invertebrate.

What is Mendel's law of segregation What do we called his factors today and where are they located?

Answers

The two alleles for a particular gene separate throughout the development of gametes, according to Mendel's law of segregation, leaving just one allele for each gamete. This indicates that just one allele from each parent is passed on to the offspring for a particular gene when the gametes combine at fertilization.

Mendel's factors have come to be known as genes. A gene is a section of DNA that contains the instructions for making a particular protein, which in turn defines a certain trait.

Chromosomes, which are situated in the nucleus of cells, are where genes are found. Each gene in diploid organisms like pea plants has two alleles, one of which is inherited from each parent.

Mendel's law of segregation explains Mendel's observed inheritance of single traits in his pea plants and it is the basis for Mendel's Punnett square, a tool that is widely used today to predict the possible outcomes of genetic crosses.

To learn more about Mendel's law of segregation

https://brainly.com/question/23067535

#SPJ4

Other Questions
which of the following is a testable hypotheses? O A. if I brush my teeth, I will get fewer cavities than if i dont brush my teeth.O B. its wrong not to brush your teeth before you have an important conversation with someone.O C. Green toothpaste taste better than blue toothpaste or red toothpaste. O D. smart, careful, healthy people always brush their teeth. Hannah is recovering hundreds of treasure chest from an ancient shipwreck she is able to recover a test every four hours to complete the table using equivalent ratios in a company, 60% of workers are women. if 800 people work on the company who aren't women, how many workers are there in all? use pencil and paper. show two different ways that you can solve this problem. how many workers in all? A college biology lab selected 65 women and 65 men at random and recorded their body temperatures (in degrees Fahrenheit). The distributions of their temperatures are shown below.Which statement gives an accurate comparison of the body temperatures of women and men shown?Question 5 options:1.)The mean body temperature for women is less than for men and women's temperatures vary more than men's temperatures.2.)The mean body temperature for women is greater than for men and women's temperatures vary less than men's temperatures.3.)The mean body temperature for women is less than for men and women's temperatures vary less than men's temperatures.4.)The mean body temperature for women is greater than for men and women's temperatures vary more than men's temperatures. A rise in oil prices has caused input prices to increase throughout the economy, causing nominal GDP to increase by 13%. Meanwhile, the price level decreases by 2%. What is the real GDP growth rate during this period Robin tosses a pair of 6-sided dice. The odds in favor of the sum of the 2 dice rolls being greater than 8 are 5:13.What is the probability that the sum of the 2 dice rolls will not be greater than 8? DefinitionUnit 6 Vocab: DNA, RNA, and Protein Synthesisnucleic acid molecule that allows for the transmission of genetic information anprotein synthesisYour answer What are the 4 names of an angle? Tech A says that all hazards can be removed from a shop. Tech B says that you should disconnect an air gun before inspecting it. Who is correct A follow-up experiment revealed that the genetic content of the bacterial cells was altered by the transfer of material from the phage. This process is best described as: PLEASE HURRY AND HELP!!!Which of the following tables represents a linear relationship that is also proportional?x y0 33 66 9x y0 42 64 8x y0 06 312 6x y0 35 510 7 what are the two quantities in this module for which we will develop unit factors to do dimensional analysis with chemical substances? Spring and Summer can alsosymbolize marriage ortogetherness. Which of thefollowing pairs was NOTbrought together in some wayduring Acts IV-V of "TheWinter's Tale"? At the places where 180 degrees of longitude and the International Date Line meet, there is a change of _________ as you cross the International Date Line. Termination of the postsynaptic potential would be expected from a drug or process that acts to a. blocks transport of the neurotransmitter molecule through the axon membrane. b. enzymatically degrade the neurotransmitter molecule. c. increase the number of postsynaptic receptors. d. increase release of the neurotransmitter. e. increase synthesis of the neurotransmitter molecule. When two lines make an angle of 90 degree is known as? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Helllllp please ???? Which of the following occurs when a person reaches the age of majority and states, either orally or in writing, that he or she intends to be bound by the contact entered into as a minor?Multiple ChoiceDisaffirmanceImplied novationImplied ratificationExpress novationExpress ratification What is the area of equilateral having side 12 cm?