the sum of the product and the sum of two positive integers is $39$. find the largest possible value of the product of their sum and their product.

Answers

Answer 1

Their sum plus their product has a maximum potential value of 420.

Given that the product of the two positive numbers and their sum is 39.

The highest feasible value of the total of their products must be determined.

Let's tackle this issue step-by-step:

Assume x and y are the two positive integers.

The product's sum is xy, while the two integers' sum is x + y.

The answer to the issue is 39, which is the product of the two integer sums and their sum.

[tex]\mathrm{xy + (x + y) = 39}[/tex]

We need to maximize the value of to discover the biggest feasible value of the product of their sum and their product [tex]\mathrm {(x + y) \times xy}[/tex].

Now, we can proceed to solve the equation:

[tex]\mathrm {xy + x + y = 39}[/tex]

To make it easier to solve, we can use a technique called "completing the square":

Add 1 to both sides of the equation (1 is added to "complete the square" on the left side):

[tex]\mathrm {xy + x + y + 1 = 39 + 1}[/tex]

Rearrange the terms on the left side to form a perfect square trinomial:

[tex]\mathrm{(x + 1)(y + 1) = 40}}[/tex]

[tex]\mathrm{(x + 1)(y + 1) = 2 \times 2 \times 2 \times 5 }}[/tex]

Now, we want to maximize the value of [tex]\mathrm {(x + y) \times xy}[/tex], which is equal to [tex]\mathrm{(x + 1)(y + 1) + 1}[/tex]

Finding the two positive numbers (x and y) whose sum is as close as feasible to the square root of 40, or around 6.3246, is necessary to maximize this value.

The two positive integers whose sum is closest to 6.3246 are 5 and 7, as 5 + 7 = 12, and their product is 5 × 7 = 35.

Finally, [tex]\mathrm {(x + y) \times xy}[/tex]

= [tex](5 + 7) \times 5 \times 7[/tex]

= 12 × 35

= 420

So, the largest possible value is 420.

Learn more about Positive Integers click;

https://brainly.com/question/18380011

#SPJ12


Related Questions

Please answer! I will give brainliest, it would make my day :-)

Write a formula for the given measure. Let P represent the perimeter in inches, and w represent width in inches. Identify which variable depends on which in the formula.

the perimeter of a rectangle with a length of 5 inches

P=

Answers

Step-by-step explanation:

p = perimeter

w = width

let the length be l

as we know that

perimeter of rectangle (p).= 2(l+ w)

p = 2 ( 5+w)

p = 10 + 2w

so here variable p is dependent on the value of w.

hope this will be helpful to you .plz mark my answer as brainlist plzzzz if you find it useful.☺️.

Write your question here (Keep it simple and clear to get the best answer)a sum of 1,5000.00 in the ratio 5:3

Answers

Answer:

Ratio 5 = 9375

Ratio 3 = 5625

Step-by-step explanation:

Write your question here (Keep it simple and clear to get the best answer)

a sum of 1,5000.00 in the ratio 5:3

The ratio is given as:

5:3

Total Proportion = 5+3 = 8

For ratio 5

= 5/8 × 15000

= 9375

For ratio 3

= 3/8 × 15000

= 5625

8 x ÷ 4 = 100 What is the value of x in the equation?
5
A. 5
B. 25
C. 50

D. 200

Answers

Answer:

Hi there. I had put a comment replying to your question as I didn't see any place that I could answer. If you still need it, then the answer was

C. 50

Step-by-step explanation:

8 * 50 = 400

400 / 4 = 100

In any way possible, I hope this helps you! Have a great day!

f(x)=6, what is x? HELP ANSWER FAST!!!!!!

Answers

Answer:

x = 6 / f

Step-by-step explanation:

can someone please help me again, i suck at math..

Answers

Answer:

18.55 - 1.75= 16.8

16.8/12= 1.4 oz

Answer- 1.4 oz

Step-by-step explanation:

Sorry if this is wrong, I suck at math, too.

Jorge builds a rectangular prism that has a volume of 42 cubic inches. Which of the following could be Jorge’s prism? (4 points)

Group of answer choices

A rectangular prism with a height of five inches, length of five inches, and a width of five inches.

A rectangular prism with a height of five inches, length of four inches, and a width of four inches.

A rectangular prism with a height of two inches, length of seven inches, and a width of three inches.

A rectangular prism with a height of six inches, length of three inches, and a width of two inches.

Answers

Answer:  A rectangular prism with a height of two inches, length of seven inches, and a width of three inches.

Step-by-step explanation:

Multiply the dimensions given, then select the one that matches Jorge's required 42 in³

5×5×5 = 125

5×4×4 = 80

2×7×3 = 42

6×3×2 = 36

Answer:

A

Step-by-step explanation:

60 people attend a game night everyone chooses to play chess a two player game or cribbage a four player game all 60 people are playing chess or cribbage if there were 8 games of cribbage played how many games of chess was played​

Answers

Answer:

there were 14 games of chess

Answer:

14 games of chess

Step-by-step explanation:

please answer correctly and quickly all question

Answers

Answer:

Step-by-step explanation:

1. 8=2x+4

8-4=2x

4=2x

x=2

2. 2x+3=9

2x=9-3

2x=6

x=3

3. 6y=54

y=54/6

y=9

5. 3= x/2

x=6

Answer:

8=2x+4

4=2x

2=x

2x+3=9

2x=6

x=3

6y=54

I'm not sure about question #4

3=x/2

6=x

How do I solve this?

Answers

Answer:

sin (330)

csc (60)

cos (390)

Step-by-step explanation:

Solve the trigonometric equation by isolating the function and then taking the inverse. Use the period to find the full set of all solutions

how to solve 15x^3/4

Answers

Answer:

            3

Simplify   —

           4

Equation at the end of step

1

:

       3

 15x • —

       4

STEP

2

:

Final result :

 45x

 ———

  4

Step-by-step explanation:

Answer:

Well...without the x I know it is 843.75 but I don't know the fraction of it so sorry! I try my best to help people!

The difference of a number and seven

Answers

Answer: x-7

Step-by-step explanation:

Answer:

x -- 7

Step-by-step explanation:

Jonathan had $40 in his bank account. He withdrew $12 and deposited $4. How much is in his bank account now?

Answers

Answer:

he 32 is what he got in bank now an hope this help.

Step-by-step explanation:

The number sentence 4×6 = 6×4 is an example of what property?

Answers

Answer:

Multiplication property of equality

Step-by-step explanation:

Which property is demonstrated in the equation 0 x 35 = 0?
A. symmetric
B. property of zero
c. associative
d. commutative​

Answers

Answer:

Step-by-step explanation:

the property of zero,

multiplication property of zero

Business woman Maya spends 1⁄4 hours a day on her cell phone. Her husband Larry spends 3⁄16 hours a day on his cell phone. What is the total time spent on the phone between the couple per day?

Answers

Answer:

45 minutes, or 3/4 hours

Answer:

the 3/4 is wrong this is how it was explained in the answer screen

Step-by-step explanation:

The correct answer is:

Create Equal Denominators

1⁄4 × 4⁄4 = 4⁄16

Total Time Spent

4⁄16 + 3⁄16 = 7⁄16 hours in a day

Mr. Lowe had to replace the fluid in his tractor tire. The tire needed 73
gallons of fluid at $1.95 per gallon. About what did it cost to replace the
needed fluid? *

Answers

Answer:

$142.35

Step-by-step explanation:

The graph shows two lines, A and B.
у
6
A
B
5
4
3
2
1
-X
0
1
2
3
4
5
6
Part A: How many solutions does the pair of equations for lines A and B have? Explain your answer. (5
Part B: What is the solution to the equations of lines A and B? Explain your answer. (5 points)

Answers

Part A: One solution because the lines intersect one time.
Part B: (3,4) or x=3 and y=4 (depending on how you have to write it)

ZB
Round your answer to the nearest hundredth.
B
?
9
A
4

Answers

Answer:

∠ B ≈ 26.39°

Step-by-step explanation:

Using the sine ratio in the right triangle

sinB = [tex]\frac{opposite}{hypotenuse}[/tex] = [tex]\frac{AC}{AB}[/tex] = [tex]\frac{4}{9}[/tex] , then

∠ B = [tex]sin^{-1}[/tex] ([tex]\frac{4}{9}[/tex] ) ≈ 26.39° ( to the nearest hundredth )

I think it’s 2 over 1 but I’m not sure??

Answers

Answer:

it is 2/1

Step-by-step explanation:

3(2t + 5) = 5t + 25
What does t equal

Answers

Answer:

t = 10

(Hope this helps! Btw, I am the first to answer. Brainliest pls!)

Answer:

hello! :) have a good day!

t = 10

Find the slope between (1,-19) and (-2,7)

Answers

Answer
4



Explanation
(1,19) (-2,7)
7-19=-12
-2-1=-3
The divide -12 and -3 and you get 4
Hope this helps

Answer:

m= -26/3  

Step-by-step explanation:

I used an app called  "M a t h w a y " (with no spaces) you should use it

it is very helpful!

Yo i need help refer to picture​

Answers

Step-by-step explanation:

AA: Two pairs of corresponding angles are equal.

ASA (Angle-Side-Angle)ASA: Two pairs of corresponding angles and the corresponding sides between them are equal. hope this helps you. means similarity would be equal.. I cannot read your paragraphs that well they are too small but I hope this helps you just got to find which paragraph it shows that they AA and AAS a are similar to each other by being equal

10.
Describe the graph of the equation x = 7. Is the equation a function?


horizontal line; no

horizontal line; yes

vertical line; yes

vertical line; no

Answers

Answer:

The answer is Vertical Line; Yes

Step-by-step explanation:

The answer is Vertical Line; Yes. This is because all equations that are "X =" will always be vertical.  

x=7 represents the equation of a function which is a vertical line

You are renting a car for the day. There is a daily fee of $25 and a charge of $0.10 per mile. Your budget allows a maximum total cost of $50. How many miles can you travel on this budget?

Answers

Answer:

250 miles

Step-by-step explanation:

daily charge: $25

per mile: $0.10

budget: $50

50-25=25

25 divided by 0.10 = 250

you can travel 250 miles on this budget

An isosceles triangle includes two 72°
angles. Which equation could be used to
find the measure of the third angle?
A X + 72 = 180
B X = 180 - 72
C 72-X= 180
D 180 - 2(72) = X

Answers

I don't understand the options but I will explain it to u!

Step-by-step explanation:

An Isosceles triangle has two equal sides that means , In this question it is given that there are two 72°angles so,

72+72+x =180

(Transpose)

x = 180-(72+72)

x = 180-(144)

Therefore, x= 36

In an isosceles triangle, two sides are equal and their opposite angles are also equal. Then the correct option is D.

What is the triangle?

A triangle is a three-sided polygon with three angles. The angles of the triangle add up to 180 degrees.

An isosceles triangle includes two 72° angles.

In an isosceles triangle, two sides are equal and their opposite angles are also equal.

And the sum of the angles of the triangle is 180°.

Let the third angle be x. Then we have

72° + 72° + x = 180°

180° - 2(72°) = x

Thus, the correct option is D.

More about the triangle link is given below.

https://brainly.com/question/25813512

#SPJ2

Greg invested $6000 in a bond with a yearly interest of 4%. His total interest on his investment was $1200. What was the length of the investment

Answers

Answer:

5 years

Step-by-step explanation:

First, converting R percent to r a decimal

r = R/100 = 4%/100 = 0.04 per year,

then, solving our equation

t = 1200 / ( 6000 × 0.04 ) = 5

t = 5 years

The time required to

accumulate simple interest of $ 1,200.00

from a principal of $ 6,000.00

at an interest rate of 4% per year

is 5 years.

The temperature in Lukeville is -13 ºC. The temperature in Metroburg is 12 ºC. How many degrees warmer is the temperature in Metroburg?

-1 ºC
1 ºC
25 ºC
-25 ºC

Answers

Answer:

25

Step-by-step explanation:

1. Make an equation: 12-(-13).

2. Solve the equation. Since there are 2 negative signs (one to the right of 12 and another to the left of 13) they can cancel each other out and they turn into an addition sign. Then, you get 12+13. You can easily solve that and you will get the answer of 25 degrees.


Name three sets of collinear points:

Possible answers:
T,U,andS
T,U and V
V,U and Q
R,V and X
W,X and Q
R,S and U

Answers

I e and u amend iuqnenr

what is six and eight seven thousandths as a decimal

Answers

Answer:

6.087

Step-by-step explanation:

0.000

^ones

   ^tenths

      ^hundredths

         ^thousandths

please do them all please

Answers

Answer:

7(3 + 3x)  =  21x + 21

2d + 10(4d +4 + 2a)  =  20a + 42d + 40

3t + 2x + x  =  3t + 3x

5(r + 12) - 25  =  5r + 35

18s + 12rs + 10r - 2rs  =  10rs + 10r + 18s

s(12 - 4) + 2  =  8s + 2

w(15 - 3) + 2 + 7w  =  19w + 2

Step-by-step explanation:

Other Questions
The generation that often tries to give up and assimilate its food patterns into the United States is the: Second generation. The predominant religion in ... Wich event occurred First in Martn luther long jrs life if accused of dismissing a potential juror because of race, what must a prosecutor do in order for the dismissal to be allowed? using the taylor remainder theorem, find all values of x for which this approximation is within 0.00447 of f ( x ) . assume for simplicity that we limit ourselves to | x | 2 . an indoor track is to be designed such that each end is a banked semi-circle with a radius of 24 m. what should the banking angle be for a person running at speed v = 6.0 m/s? What was the subtext when Tom told George that he would sell him the car?No plagiarism.Correct answers only 3cacl2(aq) 2na3po4(aq)6nacl(aq) ca3(po4)2(s) how many liters of 0.20m cacl2 will completely precipitate the ca2 in 0.50lof0.20mna3po4 solution? FILL IN THE BLANK. A system that supplies a ____ and is derived from a transformer rated no more than 1000 volt amperes does not require a grounding electrode conductor If the age of the Earth is 4.6 billion years, what should be the ratio of Opb in a uranium-bearing rock as old as the Earth? 238U 206Pb 238U = 0.9997 x determine the degree of the maclaurin polynomial of 10 sin (x) necessary to guarantee the error in the estimate of 10 sin (0.13) is less than 0.001. to test whether a change in price will have any impact on sales, what would be the critical values? use 0.05. question content area bottom part 1 a. 2.7765 b. 3.4954 c. 3.1634 d. 2.5706 which of the following are true about a strengths-based approach to motivation? check all that apply. an engineer enables packet screening in order to prevent any malicious activity over hypertext transfer protocol (http) web based traffic. which technology should the engineer utilize? Write a 4 paragraph about the pro and cons of Pasadena?Answer ASAP PLS Consider the following DNA fragment from four different suspects in a crime: Suspect 1 - ACGTACGGTCCGACCTT Suspect 2 - ACCTACGGCGGCGGTCCGACCTT Suspect 3 - ACATACGGTCCGACCTT Suspect 4 - ACGTACGGCGGTCCGACCTT Select all of the true statement(s) about these suspects and their DNA. Check All That Apply This stretch of DNA contains one SNP. This stretch of DNA contains two SNPs. Suspect 2 has three copies of an SNP. Suspects 1 and 3 have the same number of copies of an STR. Suspect 2 has three copies of an STR. can i get help on this please i don't understand it so if someone can help i will give brainy Question 5. The graph represents the path of a rock thrown from the top of a cliff by a hiker:Determine what the key features of the curve represent in terms of the path of the rock. Some ways in which lack of energy supply affects societal development Use Newton's law of gravitation to determine the acceleration of an 85-kg astronaut on the International Space Station (ISS) when the ISS is at a height of 350 km above Earth's surface. The radius of the Earth is 6.37 x 10^6m. (GIVEN: MEarth = 5.98 x 10^24 kg The enthalpy of solution is defined as Hsolnv = Hsolute + Hsolvent + Hmix. Each of the terms on the right side of the equation are either endothermic or exothermic. Which answer properly depicts this. why do you think the allies did not respond to the genocide of jews in countries under nazi control?