Answer:
Explanation:
biodiversidad
Cellular Respiration and Energy
Answer:
answers answers answers
Explanation:
1. carbohydrate
2.store energy
3.chemical energy
4. food
5. glucose
6. cellular respiration
7. ATP
Which of the following is not a function of the bacterial cell wall?
A. Provide the cell with shape and rigidity
B. Prevent the cell from lysing
C. Protect the cell
D. Provide the cell with locomotion
Answer:
D
Explanation:
I believe locomotion would be the job of the flagellum
The correct option that is not a function of the bacterial cell wall is : ( D ) Provide the cell with locomotion
The Bacterial cell wall acts mainly as a protective cover to the cell of the bacterium, protecting the cell from lysing ( preventing the breakdown of the cell via osmotic pressure ). The cell wall also provides the cell with shape a and rigidity.
While The locomotion of the cell is not the responsibility of the cell wall but it is made possible by the flagellum.
Hence the non - function of a bacterial cell wall is providing the cell with locomotion.
Learn more : https://brainly.com/question/2139006
Write one scientific question about the organism in
the photo. Sunflowers
Answer:
how do sunflowers disperse their seeds
Explanation:
The diagram below represents a sample of a sedimentary rock viewed under a
microscope. Which part was formed first?
pls help will give brainliest
Answer:
The first one is Photosythesis and the second one is Respiration
Explanation:
Which feature of the Earth's surface is caused by wind?
A)
rock quarries
B)
canyons
C)
sand dunes
for
D)
mountains
Answer:
b canyons
Explanation:
Select all that apply.
Which of the following are true about a block of ice at -10°C as you continue to apply heat.
Its temperature will rise continuously until it completely melts.
Its temperature wil rise until reaching o°C.
Its temperature will not rise above -10°C until it melts. Its
temperature will remain at 0 G until all the ice melts.
describe how you would test a sample of powdered milk to see if it contained protein
Answer:
How would you contained protein
Explanation:
One would test a sample of powdered milk to see if it contained protein by using copper sulfate solution and sodium hydroxide solution.
What is protein?A structure composed of amino acids. The body need proteins to function properly. They serve as the building blocks for several bodily components, including the skin, hair, and enzymes, cytokines, and antibodies.
An essential component of a balanced diet is protein. Amino acids are the chemical "building blocks" that make up proteins.
Amino acids are used by your body to create hormones, enzymes, and to build and repair muscles and bones. They can be utilized as a source of energy as well.
The test can be done as:
To your meal solution, add a few drops of copper sulfate solution. A few drops of sodium hydroxide solution should be added. Protein is present in the food if the solution becomes purple.Thus, using copper sulfate solution and sodium hydroxide test, one can determine the protein content in the sample.
For more details regarding protein, visit:
https://brainly.com/question/29776206
#SPJ2
What practice helps scientists avoid bias in their findings
How Green Plants Make Food
(a) ______ from the sun, (b) ______, the green coloring in the leaf of the plants combine with (c) _________ from the soil and (d) _________from the air to produce (e) ________ in the leaf. The air that enters the leaf contains carbon dioxide and oxygen. But the leaf needs only the carbon dioxide. Thus, (f) _________is given off as waste product.
Answer:
BRUU HELP IT SAYING I NEED BRAINLY PLUS
This equipment can be used for plowing ,planting,cultivating,mowing soil and pulling farm machinery,what is it?
The mutations responsible for the dark fur color in the Arizona mice were absent from the three different populations of New Mexico mice. No Mc1r mutationswere associated with dark fur color in the New Mexico populations. These findings suggest that adaptive dark coloration has occurred at least twice in the rock pocket mouse and that these similar phenotypic changeshave different genetic bases. How does this study support the concept that natural selection is not random
Answer:
Following are the solution to the given question:
Explanation:
Please find the complete question in the attached file:
In the given question, the whole study reinforces the fact which natural selection also isn't transformed through producing much more confirmation which genetic polymorphisms occur because once required as well as that they can produce the very same mutation as a function of climate transformation except in specific environments.
Emilia Burton is an 18-year-old high school student who began to experience weight loss despite a ravenous appetite and resulting increased dietary intake. She has to make frequent trips to the bathroom to urinate and has difficulty concentrating on her work because of fatigue. She drinks large volumes of coffee to help with a constant dry mouth and to combat her fatigue. At a clinic appointment, it was noted that her weight has dropped from 140 lb to 128 Ib.
a) What is the probable diagnosis of this patient? What information from the above scenario would support your diagnosis?
b) What laboratory test(s) should be performed? Which result(s) would support your diagnosis? What immediate and long-term therapy will Emilia need to manage her disorder?
c) Emilia should be aware of the potential acute and long- term complications of her condition. What are they?
Answer:
A) The diagnosis is Diabetes mellitus which is based on the given symptoms that are weight loss, dry skin, fatigue, profuse urination, ravenous hunger all confirm diabetes.
B) Test for confirmation of diabetes Mellitus are-
Fasting plasma glucose test
Postprandial glucose test
Random plasma glucose test.
A1C test
If the test shows higher blood glucose it confirms the diagnosis
Immediate Treatment:-
Medication
Long term treatment:
Exercise controls the blood sugar
Diet should be healthy and should avoid high glucose options.
C) Acute and long term complications:-
Diabetic retinopathy
Diabetic foot
Diabetic neuropathy
Coronary heart disease
Kidney damage
Cerebrovascular disease.
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For this sequence: give the expected sequence of the other DNA backbone. T-A-C-C-C-C-C-G-C-T-A-T-A-A-A-A-T-A-G-G-C-T-G-C give the RNA sequence transcribed from the original DNA backbone. U-A-C-C-C-C-C-G-C-U-A-T-A-A-A-A-U-A-G-G-C-U-G-C give the Amino Acid sequence of the protein built from the original DNA backbone.
Answer:
DNA: ATGGGGGCGATATTTTATCCGACG
RNA: AUGGGGGCGAUAUUUUAUCCGACG
Protein: MGAIFYPT
Explanation:
Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.
Where do nutrients enter the body?
Answer:
thru the nucleus or cell wall i think
Explanation:
Answer: The small intestine absorbs most of the nutrients in your food.
Explanation: The small intestine is good for absorption due to it having a large inner surface area.
Which of the following events occurs in DNA replication in prokaryotes?
a. Replication starts from a single point and proceeds in two directions until the entire chromosome is copied.
b. Replication starts from multiple points and proceeds in two directions until the entire chromosome is copied.
c. Regulatory proteins bind to all of the nucleotides on the DNA molecule.
d. Enzymes “unzip” the DNA molecule by breaking ionic bonds between base pairs.
Answer:
a. Replication starts from a single point and proceeds in two directions until the entire chromosome is copied.
Explanation:
Hope this helps
Answer:
a. Replication starts from a single point and proceeds in two directions until the entire chromosome is copied.
Explanation:
Because it is the "Correct Answer"
A scientist is observing a new species of organism. She observes that from generation to generation many of the organisms’ offspring have adaptations that their parents did not have. This organism is most likely reproducing through_______.
a. sexual reproduction
b. budding
c. asexual reproduction
d. binary fission
Which of these is an impact of burning coal for energy?
A. acid rain
B. mercury released into the waterways
C. Increased carbon dioxide in the environment
D. all of the above
In which direction is heat transferred?
thermal energy or heat naturally flows in one direction only: from hot toward cold. Heat moves naturally by any of three means.
hope it helps.
Apply: Suppose a template strand of DNA had the following sequence: T A C G G A T A A C T A C C G G G T A T T C A A What would be the complementary strand of mRNA?
The corresponding nucleotide sequence is present on the coding strand. No complementary sequence exists on the template strand.
What changes occur in complementary strand from template?The DNA strand from which the mRNA is produced is known as the template strand. The DNA strand opposite the template strand is known as the coding, or non-template, strand, and it has the same sequence as mRNA except T to U substitutions.
The template strand, one of the two exposed DNA strands, acts as a model for transcription.
The RNA product is essentially identical to the non template (or coding) strand of DNA and is complementary to the template strand.
Therefore, AUG CCU AUU GAU GGC CCA UAA GUU is the complementary strand of mRNA.
Learn more about complementary strand here:
https://brainly.com/question/13768651
#SPJ3
How do bacteria multiply again? Use the key terms genetic information, DNA, split in two, and exponential growth.
Answer:
Bacteria are asexual. This means that they are not like us, as they do not need a partner to multiply. A bacterium can become two bacteria all by itself. Then those two bacteria can each multiply again on their own and so, they become four bacteria.
Explanation:
Hope this helped Mark BRAINLEST!!!
PLEASE HELP!!!!
Explain what causes a muscle to go into rigor mortis. Your answer should include the circumstances which cause it, as well as why those circumstances cause the effect (what is happening in the muscle at a molecular level which causes the stiffness).
Explanation:
Rigor mortis develops as the body's energy source (adenosine triphosphate [ATP]) is depleted. Muscle fibers require ATP for relaxation; once depleted, actin and myosin proteins remain complexed, resulting in stiffening of the muscles..
Thanks my answer and vote it 5 star and Mark it in brainliest answers please please please please please please please please please please please please please please please please please please please please please please
A cluster of cases of legionellosis have occurred in your neighborhood. People with the illness have cough, fever, shortness of breath, chest pain and sometimes diarrhea. The illness is caused by the bacterium Legionella pneumophila, a facultative intracellular parasite that survives in certain ameba. The organism has an absolute requirement for L-cysteine. Typically, the organism is grown on buffered charcoal yeast extract (BCYE) agar. In some labs, samples containing suspected L. pneumophila are cultured on traditional BCYE medium as well as BCYE medium lacking L-cysteine. How would L. pneumohila be identified in this situation
Answer:
The correct answer is - comparing the presence of an essential component of the L. pneumophila that is cysteine.
Explanation:
As we know that L-cysteine is essential for the organism L. pneumophila to grow its colonies. The identification is easy in this situation by comparing the two cultured on the traditional BCYE medium and BCYE medicum without L-cysteine.
Colonies that grow on traditional BYCE medium are likely L. pneumophila as they required L-cysteine but not on BYCE medium lacking cysteine.
in what parts of the cycle do you think phosphorus spends the most time
Answer:
what is a phosphorus
Explanation:
Please Help!!!!
Muscles intended for large, powerful contractions contain llx muscle fibers. true or false
Answer:
True
Explanation:
Been learning and know
Determine the rate of oxygen consumption at each temperature for comparison. Then divide the higher rate by the lower rate to obtain the difference (ratio) between the two temperatures. Round your answer to the nearest 0.1. It can be concluded that mouse respiratory rate (increases or decreases) when temperature is lowered. In this experiment there was a fold difference in respiratory rate at the two temperatures.
Answer:
In mice rate of respiration increases as the temperature drops.
Explanation:
As the temperature decreases, the respiration rate also decrease because the body needs less oxygen for the production of energy. But in the case of mice, the rate of respiration decreases and the reason is the fear. Results showed that the respiration increased in mice as the decrease in temperature occur, caused due to the fear instilled in the mice towards cold temperature so in mice rate of respiration increases as the temperature drops.
19. Fresh poultry should be rejected when:
A. It has been shipped in plastic wrap
B. It is slightly sticky to the touch
C. There is no discoloration
D. The receiving temperature is 38°F
Answer:
B
Explanation:
Fresh poultry should be rejected when the receiving temperature is 38°F. Therefore, option (D) is correct.
Poultry must be stored and transported at or below 40°F to guarantee food safety and inhibit the proliferation of harmful bacteria. Exposure to unsafe temperatures during storage or transportation can increase the risk of bacterial contamination and foodborne illness if the receiving temperature exceeds the threshold.
Indicators like plastic wrap during shipment, slight stickiness, or lack of discoloration do not necessarily imply safety concerns or spoilage with fresh poultry, as mentioned in the other options.
Learn more about poultry, here:
https://brainly.com/question/23008732
#SPJ6
You perform an experiment in which chromatin is isolated from sea urchin sperm cells and briefly digested with micrococcal nuclease. When the chromatin proteins are removed and the resulting purified DNA is analyzed by gel electrophoresis, you observe a series of DNA fragments that are multiples of 260 base pairs in length (that is, 260 bp, 520 bp, 780 bp, and so forth). a) Although these results differ somewhat from the typical results discussed in the chapter, explain why they still point to the likely existence of nucleosomes in this cell type. b) What can you conclude about the amount of DNA that is associated with each nucleosome
Answer:
a) DNA fragments associated with histone proteins are all multiple in length (i.e., 260 bp, 520 bp, 780 bp, etc), thereby suggesting the presence of a pattern of organization in the chromatin
b) it suggests that each unit of organization (ie, each nucleosome) consists of 260 bp associated with chromatin proteins
Explanation:
The nucleosome is considered as the basic unit of chromatin. A nucleosome consists of approximately two turns of DNA wrapped around a core of eight histone proteins (i.e., a histone octamer). The histone octamer consists of two copies of each of the histones H2A, H2B, H3, and H4. Moreover, the nucleosomes are connected together by linker DNA sequences which vary between 10 and 100 bp in length.
These are carbohydrates -rich vegetables EXCEPT
a. Tubers
b. nuts
c. seeds
d.roots
which are characteristics of epithelial cells? Select two options.( Answer Needed ASAP)
Answer:
found lining many areas that contact the external environment
plays a role in protection
Explanation:
Explanation: Epithelial tissue is composed of cells laid together in sheets with the cells tightly connected to one another. Epithelial layers are avascular, but innervated. Epithelial cells have two surfaces that differ in both structure and function.