Select ALL the correct answers.
Select all the expressions that are equivalent to the polynomial below
(3x-7)(2x+8)

Select ALL The Correct Answers. Select All The Expressions That Are Equivalent To The Polynomial Below

Answers

Answer 1

Answer:

A. 4(x - 4) + 2(3x² + 3x - 20)

C. (11x² + 7x - 55)-(5x² - 3x + 1)

F. (3x² + 5x - 28) + (3x² + 5x - 28)

Step-by-step explanation:

Given:

(3x-7)(2x+8)

= 6x² + 24x - 14x - 56

=6x² + 10x - 56

A. 4(x - 4) + 2(3x² + 3x - 20)

= 4x - 16 + 6x² + 6x - 40

= 6x² + 10x - 56

B. (3x² + 5x - 28) - (2x² + 4x + 28)

= 3x² + 5x - 28 - 2x² - 4x - 28

= x² + x - 56

C. (11x² + 7x - 55)-(5x² - 3x + 1)

= 11x² + 7x - 55 - 5x² + 3x - 1

= 6x² + 10x - 56

D. 4(x - 4) - 2(3x² + 3x - 20)

= 4x - 16 - 6x² - 6x + 40

= - 6x² - 2x + 24

E. (11x² + 7x - 55)-(5x² - 3x + 2)

= 11x² + 7x - 55 - 5x² + 3x - 2

= 11x² - 5x² + 7x + 3x - 55 - 2

= 6x² + 10x - 57

F. (3x² + 5x - 28) + (3x² + 5x - 28)

= 3x² + 5x - 28 + 3x² + 5x - 28

= 6x² + 10x - 56


Related Questions

The pair of triangles below have two corresponding parts marked as congruent. What additional information is
needed for a HL congruence correspondence?

A. ∠M≅∠H
B. LM≅JK
C. LM≅JH
D. LN≅JK
(there is a line above the letters besides a)

Answers

Answer:

C. LM ≅ JH

Step-by-step explanation:

The criteria that needs to be satisfied before two right triangles can be said to be congruent to each other is by the Hypotenuse-Leg Theorem are:

1. Both must have a corresponding leg that are congruent to each other.

In the diagram given above, NM is congruent to KH. They are corresponding legs that are congruent.

2. The hypotenuse of one triangle must be equal to that of the other.

We are not given if the hypotenuse of one, LM is congruent to the hypotenuse of the other, JH.

Therefore, the additional information required would be:

LM ≅ JH

A video game has a wheel that turns one degree every time the figure pops a ballon then figure has popped 40 balloons how many degrees has the wheel turned?

Answers

The wheel turned 600 degrees

If g(x) = x^2 - 3, find the value of:

a) g(5)
b) g(-2)
c) g(a+1)

Answers

Answer:

this answer kajjsnnsnsnsnsnsnsnsnssnnsnssnjxxjxnxnxxnndnsndnsndndnd

Answer

g(5)=22

g(-2)=1

g(a+1)=(a+1)^2-3

g(a+1)= (a+1)(a+1)-3

g(a+1)=a^2+2a-2

Step-by-step explanation:

if you wanted to solve for a you would need to use the quadratic formula and solve for a.

During a sale, a store offered a 20% discount on a stereo system that originally sold for $320. After the sale, the discounted price of the stereo system was marked up by 20%.

Answers

Answer:

354 $ is correct

Step-by-step explanation:

your v id dead

Bal Bharti Vidyalaya is located in the Karauli district of Rajasthan. The school decided to go for a plantation drive for 2 days on the occasion of Vanmahotsava. The Principal of the Vidyalaya asked the forest department to provide plants. It was decided that each student has to plant an equal number of trees on both days. On the first day, all the participants planted 5 trees each. The number of boys and girls who participated was in the ratio 5:4. (i) If the number of trees planted by the students on the first day was 5400, how many boys participated? [1] (ii) Find the total number of students who participated in this program? [1] (iii) If the total number of trees planted on the second day was 7560, then how many trees were planted by each one of them

Answers

Answer:

i). 600 Boys

ii). 1080 Students

iii). 7 Trees each students On Second day

Step-by-step explanation:

According to the Question,

Given, Bal Bharti Vidyalaya is located in the Karauli district of Rajasthan. The school decided to go for a plantation drive for 2 days on the occasion of Vanmahotsava. The Principal of the Vidyalaya asked the forest department to provide plants. It was decided that each student has to plant an equal number of trees on both days. On the first day, all the participants planted 5 trees each. .The number of boys and girls who participated was in the ratio of 5x:4x.

i).  If the number of trees planted by the students on the first day was 5400.

We Know, Each Student Has Planted 5 Plants on First day So, Girls And Boys Ratio are 5x : 4x , Thus Total Students Are 9x .

NOw, This 9x Planted 9x × 5 ⇒ 45x Trees on First Day.

45x = 5400 ⇔ x=120

So, The Number Of Boys Are 5x = 5 * 120 ⇒ 600Boys

And, The Number of Girls Are 4x = 4 * 120 ⇒ 480Girls

ii).  the total number of students who participated in this program is 600 boys + 480 Girls = 1080 Students.

iii). If the total number of trees planted on the second day was 7560. We Know Every Student Plant Equal Number Of trees on each day.

So, 1080 Students Planted 7560 Plants

Therefor, each Student Planted 7560/1080 = 7 Trees Each On Second day.

What additional information could be used to prove AABC = AMQR using SAS? Select two options.​

Answers

Answer:

To prove that ΔABC ≅ ΔMQR using SAS, we show that two sides with the intersection angle are congruent. From the diagram, it is shown that CA is congruent to RM. From the first option, given that m∠A = 64° and AB = MQ = 31 cm, then we have CA = RM, AB = MQ, and CAB = RMQ (i.e. m∠A = m∠M = 64°).

Answer the question in the picture

Answers

Answer:

(10^3)^2

Hope this answer is right!!

Step-by-step explanation:

(10^3)^2

(10)^3*2

(10)^5

The length of the base of an isosceles triangle is x. The length of a leg is 3x−7. The perimeter of the triangle is 77. Find x.

Answers

Answer: x=13


Step 1: Define isosceles triangle

In an isosceles triangle, two sides and angles are equal. The equal sides will be the legs.

Step 2: Write an equation

To write an equation we must first consider the information discussed in step 1. Since we know that the legs will be equal, we will add that to the equation twice. The base and legs will be on one side of the equation, and the perimeter will be on the other. Now we can write the equation!

x+3x-7+3x-7=77

Step 3: Combine like terms

Like terms are terms that share the same variable, or lack of. Let’s add/subtract these now.

x+3x-7+3x-7=77
7x-14=77

Step 4: Solve for x

Let’s do the last part of the equation and solve for x, our final answer.

*Rewrite equation*
7x-14=77
*Add 14 to both sides*
7x=91
*Divide 7 on both sides*
x=13

This is your answer. Hope this helps! Comment below for more questions.

Why would there be a difference between percentages with the Empirical Rule and the actual percentages?

Answers

Answer:

Given that [tex]\int\limits^a_b {\frac{1}{2\pi } e^{-1/2} x} \, dx[/tex]   is not the easiest equation to solve, and that

the values at the convenient ± 1 sigma,± 2 sigma,± 3 sigma are irrational

using the "rule-of-thumb" "empirical rule" is typically "close enough"

given that the whole probability analysis by definition has some uncertainty in it

Step-by-step explanation:

The percentages of a normal distribution data lies within three standard deviations of its mean for empirical rule while it's definite for actual percentages.

What is the empirical rule?

The empirical rule is also referred to as the 68-95-99.7 rule and it can be defined as a rule in statistics which states that:

The middle 68% of a normal distribution would be within one standard deviation of its mean (µ ± σ).The middle 95% of a normal distribution would be within two standard deviations of its mean (µ ± 2σ).The middle 99.7% of a normal distribution would be within three standard deviations of its mean (µ ± 3σ).

In Statistics, there is a difference between percentages calculated by using the empirical rule and the actual percentages because a normal distribution data lies within three standard deviations of its mean for the former but it is definite for the latter.

In conclusion, the empirical rule is more important to researchers and statistician because it can be used to determine outcomes and gain insight even when all the data aren't available.

Read more on normal distribution here: https://brainly.com/question/4637344

#SPJ6

Which number line represents the solution set for the inequality 3(8 – 4x) < 6(x – 5)?

A number line from negative 5 to 5 in increments of 1. An open circle is at 3 and a bold line starts at 3 and is pointing to the left.
A number line from negative 5 to 5 in increments of 1. An open circle is at 3 and a bold line starts at 3 and is pointing to the right.
A number line from negative 5 to 5 in increments of 1. An open circle is at negative 3 and a bold line starts at negative 3 and is pointing to the left.
A number line from negative 5 to 5 in increments of 1. An open circle is at negative 3 and a bold line starts at negative 3 and is pointing to the right.

Answers

Answer:

3 < x

Step-by-step explanation:

3(8 – 4x) < 6(x – 5)

Divide each side by 3

3/3(8 – 4x) < 6/3(x – 5)

(8 – 4x) < 2(x – 5)

Distribute

8-4x < 2x-10

Add 4x to each side

8-4x+4x < 2x-10+4x

8 < 6x-10

Add 10 to each side

8+10 < 6x-10+10

18 < 6x

Divide by 6

18/6 < 6x/6

3 < x

Question 3 of 10
of the way from
What is the location of the point on the number line that is
A = 5 to B = 23?
O
A. 8
B. 9
C. 10
D. 7

Answers

Answer:

B. 9

Step-by-step explanation:

solve it and u will find out

What is the slope that passes through the points (-9.-8) (-15,-16)

Answers

Answer:

Slope/gradient is 4/3

Step-by-step explanation:

Have a nice day

Answer: 4/3
Y intercept is 0

Which statement about the angles in the figure is true?
mZ3+ m25 = 180°
mZ1 + m28 = 90°
m28+ m29 = 90°
m27 +mZ10 = 180°

Answers

Answer:

the second one

Step-by-step explanation:

its the sum oh 90

how to find the area of triangle?​

Answers

Answer:

[tex](i). \\ { \tt{area = 2(\frac{1}{2} \times base \times height}} )\\ = 4 \times 3 \\ = 12 \: sq \: units \\ \\ (iii). \\ = \frac{1}{2} \times 8 \times 6 \\ = 24 \: sq \: units \\ \\ (ii). \\ = \frac{1}{2} \times 12 \times 5 \\ = 30 \: sq \: units[/tex]

Toby ran a 10-kilometer race in

1 hours. Which point on the number

line represents his time?

Answers

Answer:

Point S

Step-by-step explanation:

Given that :

Time taken = 1 2/5 hours

Converting to decimal :

1 2/5 = 7/5 = 1.40 hours

From the number line, distance between each successive tick mark represents, 0.05 hours :

Hence, the point which depicts Toby's time on the number line is: point S

(5a + 2)(a + 4) =
(Answer should be a polynomial in standard form.

Answers

Answer:

(5a+2)(a+4)

=5a^2+20a+2a+8

=5a^2+22a+8

Answer:

[tex]5 {a}^{2} + 22a + 8[/tex]

Step-by-step explanation:

[tex](5a + 2)(a + 4) \\ 5a(a + 4) + 2(a + 4) \\ 5 {a}^{2} + 20a + 2a + 8 \\ 5 {a}^{2} + 22a + 8 \\ [/tex]

A teacher has 40 learners in her class. She chooses 1% to clean her board. Is this possible?​

Answers

Step-by-step explanation:

No, 1% of 40 is the same as 40% of 1. Which is 0.025% You cant have 0.025% of a learner or a human so this isn't possible.

My son wants to celebrate his birthday at the bowling alley with a few of his friends. He has $70 to spend. The bowling alley charges a flat fee of $40 for a private party and $4.50 per person for shoe rentals and unlimited bowling.

The maximum number of people he can pay for at the bowling alley is __.​

Answers

Answer: he can pay for 6 people total (including him)

Step-by-step explanation:

first lets subtract the flat fee from the total amount of money he has

70 - 40 = 30

now lets divide 30 by  $4.50 to see how many people he can pay for

30 / $4.50 = about 6.5

obviously you cant pay for half a person so he can invite 5 people (he also has to pay for himself)

Answer:

6 people

Step-by-step explanation:

What is the area is square feet?

Answers

Answer:

A = 24

Step-by-step explanation:

Figure shown is a trapezoid

Area of a trapezoid = [tex]\frac{a+b}{2} h[/tex]

where a and b = base lengths and h = height

The trapezoid shown has the following dimensions

Shorter base length (a) = 6

Longer base length (b) = 10

Height (h) = 3

Using these dimensions , plug in the values into the area formula

A = [tex]\frac{6+10}{2} 3[/tex]

add 6 + 10 = 16

[tex]A=\frac{16}{2} 3[/tex]

divide 16/2 = 8

[tex]A = (8)(3)[/tex]

multiply 8 times 3

A = 24

Using the quotient rule, what is the derivative of the function f(x)=(3x-5)/(5x+2)?​

Answers

Answer:

[tex]\frac{31}{(5x+2)^2}[/tex]

Step-by-step explanation:

See image for quotient rule

f(x)= numerator = 3x-5

g(x)= denominator = 5x+2

so we have

[tex]\frac{(5x+2)(3x-5)'-(3x-5)(5x+2)'}{(5x+2)^2}\\(3x-5)'=3\\(5x+2)'=5\\\frac{(5x+2)(3)-(3x-5)(5)}{(5x+2)^2}\\\frac{15x+6-(15x-25)}{(5x+2)^2}\\\frac{31}{(5x+2)^2}[/tex]

I need help........... ​

Answers

Answer:

4

Step-by-step explanation:

Break down the shape into a rectangle and a triangle

To find the base of the triangle subtract

(3x-1)-(x+1)= 2x-2

which means the area of the triangle is

.5(2x-2)(x-1)= x²-2x+1

Let's then find the area of the rectangle

(x+1)(x-1)= x²-1

Take the sum and set this equal to 40

(x²-2x+1)+(x²-1)=40

simplify...

2x²-2x-40=0

x²-x-20=0

(x-5)(x+4)=0

Reject the negative answer and get x=5

Then it's just a matter of plugging in x=5 for the height (x-1)

5-1=4 which is the final answer

Answer:

4 cm.

Step-by-step explanation:

Area formulas:

A(Rectangle) = bh

A(Triangle) = 1/2bh

A(Trapezium) = A(Rectangle) + A(Triangle)

Use the information given and substitute the values to solve for the missing height:

A(Rectangle) + A(Triangle) = A(Trapezium)

bh + 1/2bh = 40

(x + 1)(x - 1) + 1/2(2x - 2)(x - 1) = 40

x² - 1 + x² - 2x + 1 = 40

2x² - 2x = 40

2x² - 2x - 40 = 0

Use Quadratic Formula to solve for x:

a = 2, b = -2, c = -40

x = (-b ± √(b² - 4ac))/2a

x = (-(-2) ± √((-2)² - 4(2)(-40)))/2(2)

x = (2 ± 18)/4

x = 5 and x = -4

Since we cannot have a negative height, we use x = 5:

h = (5) - 1 = 4

Therefore, the height of the trapezium is 4 cm.

Suppose that a randomly generated list of numbers from 0 to 9 is being used
to simulate an event that has a probability of success of 80%. Which of these
groups of numbers could represent a success?
A. 0, 1, 2, 3, 4, 5, 6, 7, 8
B. 0, 1, 2, 3, 4, 5
C.0, 1, 2, 3, 4, 5, 6, 7
D. 0, 1, 2, 3, 4, 5, 6

Answers

Answer:  C.0, 1, 2, 3, 4, 5, 6, 7

========================================================

Explanation:

There are 7 numbers in the set {1,2,...,6,7}. Then we add on 0 to get to the 8th number. So there are 8 numbers overall listed in bold above.

Since the sample space is {0,1,2,...,8,9}, we have 10 digits listed here. So the probability of success is 8/10 = 0.80 = 80%

Side note: The values 8 and 9 would represent a failure. We have 2 failures out of 10 so we get 2/10 = 0.20 = 20%

The groups of numbers could represent a success 80 percent is {0, 1, 2, 3, 4, 5, 6, 7}. Therefore, option C is the correct answer.

What is the probability?

Probability can be defined as the ratio of the number of favourable outcomes to the total number of outcomes of an event.

We know that, probability of an event = Number of favourable outcomes/Total number of outcomes.

Here, the sample space is {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}

To simulate an event that has a probability of success of 80%.

Now, 8/10 ×100

= 8×10

= 80%

Therefore, option C is the correct answer.

To learn more about the probability visit:

https://brainly.com/question/11234923.

#SPJ7

Find the ratio of sin (A)

Answers

Answer:

sin (A) = 8/17

Step-by-step explanation:

Sine = opposite/hypotenuse

Sin (A) = 16/34

Sin (A) = 8/17

Answer:

sin (A) = 16/34

Step-by-step explanation:

SOH (sine = opposite/adjacent)

Matthew was assigned 234 math problems over the weekend. He completed five times as many problems on Saturday than Sunday. How many math problems did Matthew solve on Saturday?

Answers

Answer:

[tex]195[/tex]

Step-by-step explanation:

Let [tex]a[/tex] represent the number of math problems Matthew solved on Sunday. From the problem, we know he solved [tex]5a[/tex] problems on Saturday.

Therefore, we have:

[tex]5a+a=234,\\6a=234,\\a=39[/tex]

Substitute [tex]a=39[/tex] into [tex]5a[/tex]:

[tex]5(39)=\boxed{195}[/tex]

pls help me solve pls show how you got the answer

Answers

Answer:

A

Step-by-step explanation:

270/9=30

In the right triangle shown in the diagram below,
what is the value of x to the nearest whole number?

Answers

Answer: (3) 21

Step-by-step explanation: 20.78 rounded to 21


42, 43, 44, 44, 49, 40, 39
What is the mean?

Answers

Answer:

43

Step-by-step explanation:

To find the mean, add up all the numbers

(42+ 43+ 44+ 44+ 49+ 40+ 39)=

301

Then divide by the number of terms

301/7

43

Answer:

mean = 43

Step-by-step explanation:

Mean is given by

mean = sum of all numbers / total no. of terms

substitute the values

mean = 42 + 43 + 44 + 44 + 49 + 40 + 39 /

Divide ,

mean = 301 / 7

mean = 43

Which of the following equations
has - 4 as a
as a possible value of p

Answers

Answer:

You need to add the eqautions

Step-by-step explanation:

Mary took 8 tests in science and received the following scores: 87,60,76,92,63,91,88,75

Answers

Answers:

mean = 79mode = nonemedian = 81.5

=================================================

Explanation:

To get the mean, you add up the numbers and then divide by n = 8, since there are 8 scores

Adding the scores gets us: 87+60+76+92+63+91+88+75 = 632

Divide that over n = 8 to get 632/n = 632/8 = 79

The mean is 79

You have the correct answer. Nice work.

---------------

The mode is the most frequent value.

In this data set, we don't have any repeated values. Each unique number is listed one time only. So that tells us we don't have a mode here.

---------------

To get the median, we need to sort the items from smallest to largest

{87,60,76,92,63,91,88,75} sorts to {60,63,75,76,87,88,91,92}

Because we have n = 8 values, which is an even number, this tells us that the median is between slot n/2 = 8/2 = 4 and slot 5

The values 76,87 are in slots four and five in that order. Add them up and divide by 2:  (76+87)/2 = 163/2 = 81.5 is the median

Someone plss help me on this one too!
Thanks :)

Answers

Answer: 30%

Step-by-step explanation:

Other Questions
Barry Boots Inc. is considering adding a new line of boots. Based on preliminary market research, management has decided that each pair of boots should be priced at $300. Furthermore, management believes that the profit margin should be 30 percent of sales revenue.What is the target cost?a. $150.75b. $225.50c. $260.00d. $157.50 Cho hai in tch q1=q2=8.10^-7 C t cch nhau 5cm. Xc nh cng in trng ti im:a. Cch q1=2cm, q2=3cmb. Cch q1=5cm, q2=10cmc. Cch q1=5cm, q2=5cmd. Cch q1=4cm, q2=3cm Why does Australia have such unique biodiversity (variety of animals and plants) in its fauna and flora? Apothem=A) 4 units B) 4 (square root) 2 units C) 4 (square root) 3 units Solve for x. 8x = 35 A brick staircase has a total of 17 steps The bottom step requires 131 bricks. Each successive step requires 5 less bricks than the prior one. How many bricks are required to build the staircase? Evaluate x2+9/x2 for each of the given values.What is the value of the expression when x = 3?2310undefinedWhat is the value of the expression when x = 1?2310 undefinedWhat is the value of the expression when x = 0?2310undefined A supervisor is suspicious of a new female employee in an automotivecompany. This is an example of...DiscriminationDiversityPrejudiceTolerance Four relatively recent fossil species were recovered, and when the DNA was extracted, investigators observed that Species W and Z both had long finger bones, and species X and Y had short finger bones. Based upon this information and the hypothetical molecular data below, sequenced from common regions in one gene of their DNA, which two species are the most closely related to each other?Species W:AACATTGCTTTTGTAACGAASpecies X:AACCGCGCGTTTGGCGCGCASpecies Y:AGCAGCGCTTTCGTCGCGAASpecies Z:AACCGCGCTTTTGGCGCGAAA) Species X and ZB) Species W and ZC) Species Y and ZD) Species X and Y Our town has ____ museum we could visit Which of the relations below is a function? *2 points{(2, 3), (3, 4), (5, 1), (2, 4)}{(2, 3), (3, 4), (6, 2), (7, 3)}{(2, 3), ( 3, 4), (6, 2), (3, 3)}{(2, 4), ( 3, 4), (6, 3), (3, 3)} PLEASE HELP, WILL GIVE BRAINLIEST FOR RIGHT ANSWER!Indicate the equation of the given line in standard form, writing the answer in the equation box below. The line that contains the point Q (1, -2) and is parallel to the line whose equation is y 4 = 2/3 ( x 3) Activity: write 3 three sentence about the picture. use the correct forms of adjectives in your sentence What type of force are you exerting when you lie on a bed?A. Electric forceB. Magnetic forceC. CompressionD. Tension The first step in the control process is ________. A) setting the desired moralsB) measuring actual performanceC) comparing performance against expectations D) applying managerial control necesito informacin sobre doble toque en voleibol Pls help me answer this :,(What is the equation of the quadratic graph with a focus of (5, 6) and a directrix of y = -12? Does anyone know the answers with big ideas! In Act I, scene ii, Claudiuss mention of Fortinbras raises the issue of _____. the cause of King Hamlets death how Fortinbras is better than Hamlet an external threat to Denmark corruption in Denmarks government Research a modern-day pioneer who became famous for accomplishing something great or moving humanity forward. Someone like Albert Einstein, Orville and Wilbur Wright, or Walt Disney.Analyze and identify how this person maintained a youthful outlook and introduced energy and excitement into their life.Write a short paragraph on one of their great accomplishments, and why they were passionate enough to see it through. Share your short paragraph and a picture of the person on one of your social media pages. What kind of comments did you get from your post? Upload a screenshot of your post here.