Please help
25 points and Brainliest

Please Help 25 Points And Brainliest

Answers

Answer 1
B motorcycle. Matches a simpliler and non electric form of lighters just like a bike is a simpler no electric form of a motorcycle

Related Questions

In this excerpt, the writer is providing a thesis that reflects topic and viewpoint. ending the essay with a strong conclusion. analyzing the advertising methods of the ad. giving an explanation of the target audience.

Answers

In this excerpt, the writer is D. giving an explanation of the target audience.

What is a Target Audience?

This refers to the group of persons that an author has in mind when writing a book, making a speech, or generally, giving information.

Hence, we can see that from the complete question, the narrator talks about the media response essay that has an ad that features a brightly colored banner and a couple of twenty-somethings sitting comfortably together.

This shows that the target audience of the writer is young people and what the writer is trying to achieve is giving an explanation of the target audience.

The complete question reads thus:

Read the following excerpt from a media response essay

The ad features a brightly colored banner and a couple of twenty-somethings sitting comfortably together,

smiling happily, and sharing a set of headphones to listen to music. Certainly, the ad will catch the attention of

and appeal to young adults.

In this excerpt, the writer is

A.providing a thesis that reflects topic and viewpoint.

B.ending the essay with a strong conclusion

C.analyzing the advertising methods of the ad.

D.giving an explanation of the target audience.

Read more about target audiences here:

https://brainly.com/question/20812603

#SPJ1

Read the excerpt from 'The Most Dangerous Game," by
Compare the film adaptation of the scene to the text.
Richard Connell.
Which analysis best explains the effect of adding the
His foot touched the protruding bough that was the
female character to the scene in the film adaptation?
trigger. Even as he touched it, the general sensed his
danger and leaped back with the agility of an ape. But he
O She advances the plot. Having her run through the
was not quite quick enough; the dead tree, delicately
jungle moves the events of the story along.
adjusted to rest on the cut living one, crashed down and
• She serves a practical function. Using her bracelet 1
struck the
general a glancing blow on the shoulder as it
create the trap makes it more realistic to the
fell; but for his alertness, he must have been smashed
audience.
it. beneath it. He staggered, but he did not fall; nor did he
drop his revolver. He stood there, rubbing his injured

She raises the stakes. Giving the audience another
shoulder, and Rainsford, with fear again gripping his
character to care about increases the suspense level
heart, heard the general's mocking laugh ring through the
• She balances the film by providing a woman's
jungle.
perspective of the events that unfold in the jungle.
Mark this and return
Save and Exit
Submit

Answers

She raises the stakes. Giving the audience another shoulder, and Rainsford, with fear, again gripping his character to care about increases the suspense level

Apart from that, we're with Rainsford. “The maximum dangerous sport” is the tale of Rainsford's transformation of perspective. He starts by having no sympathy for animals or prey and finally ends up experiencing precisely what the prey does while being hunted. But Rainsford may be a little irritating as a story voice.

The tale is stimulated with the aid of the massive-sport hunting safaris in Africa and South US that have been especially elegant among wealthy Americans inside the Nineteen Twenties.

In "The maximum dangerous recreation," Zaroff stated, "I have electricity, we strive to be civilized right here." this is ironic because how is looking humans for a foyer being civilized? additionally, when the looking is going on, his island is chaotic, no longer civilized.

Learn more about The Most Dangerous Game here https://brainly.com/question/391842

#SPJ1

During a soccer game, a coach wants to call a "time out," so he holds up his hands to form the letter t. what type of gesture is the coach using?

Answers

Answer: Nonverbal communication code sent by the body, including gestures, posture, movement, facial expressions, and eye behavior.

Explanation: if wrong sorry.

What is the best theory for the cause of strife between generations in mesopotamia?

Answers

Family dynamics was the cause of strife between generations in Mesopotamia.

The family dynamics became the reason of conflict between generations in Mesopotamia because of societal changes and the differences between the civilization focused on cities of Mesopotamia.

Economic and social continuation in Mesopotamia's agricultural society was based on inheritance. Families must be centered on complicated relationships that include both affection and exploitation because this was one of the causes of conflict.

The degree of generational enmity is significantly influenced by factors including "whether the households were nuclear or multigenerational" and if the adult sons could inherit before the father died or had to wait until he passed away.

To learn more about generations in Mesopotamia here

https://brainly.com/question/5619981

#SPJ4

What does the following quote mean?

"Distrust naturally creates distrust, and by nothing is good-will and kind conduct more speedily changed than by invidious jealousies and uncandid imputations, whether expressed or implied."

Answers

The meaning of the quote "Distrust naturally creates distrust, and by nothing is good-will and kind conduct more speedily changed than by invidious jealousies and uncandid imputations, whether expressed or implied." is to illustrate the importance of honesty.

What is a quote?

It should be noted that a quote is the repetition of a sentence, phrase, or passage from speech or text that someone has earlier said or written. It should be noted that in oral speech, a quote is the representation of an utterance.

A quote is something that a speaker actually said which is introduced by a quotative marker, such as a verb of saying.

In this case, the meaning of the quote "Distrust naturally creates distrust, and by nothing is good-will and kind conduct more speedily changed than by invidious jealousies and uncandid imputations, whether expressed or implied." is to illustrate the importance of honesty.

Honesty is important for the growth and development of a country.

Learn more about quote on:

brainly.com/question/2762082

#SPJ1

Write a letter to the district education director why you think caning should be bound

Answers

The letter to the district education director.

Write a letter to the district education director why you think caning should be bound?

Dear Sir,

The need to ban canning in school

I write to express my concern about caning in our schools in the district as a means of restoring learners’ unacceptable behaviors.

Caning is generally used by teachers as a discipline in schools. The application of the point on the student’s buttocks, calves, arms, or palms takes residence in groups and front of the class almost every day.

This physical discipline used in academies has outlived its reputation today as many advanced countries have discovered better ways to convert learners.

Today, this mechanism of updating learners is constructing problems for teachers, head lecturers, and the ministry of teaching.

Yours faithfully,

To learn more about teaching, refer to:

https://brainly.com/question/14591988

#SPJ9

In Act III, scenes iii and iv of Romeo and Juliet, how does Capulet complicate the central conflict?

by banishing Romeo for killing Juliet’s cousin Tybalt
by forcing Paris to marry Juliet against his will
by deciding to hasten Juliet’s marriage to Paris
by refusing to recognize Romeo and Juliet’s marriage

Answers

Answer:

C) by deciding to hasten Juliet’s marriage to Paris

Explanation:

Juliet finds herself in a situation where she believes she has no choice but to go against her wishes. As a result, she comes up with a plan of action. Juliet would drink a concoction that would make her look dead. Romeo had trouble getting the letter from Friar Laurence that said Juliet's death was a lie. Because of this, he thinks Juliet has died and kills himself.

In Act III, scenes iii and iv of Romeo and Juliet, how does Capulet complicate the central conflict C) by deciding to hasten Juliet’s marriage to Paris

What is a Conflict?

This refers to the disagreement that exists between different parties that leads to a constant struggle.

Hence, we can see that from the complete text, there is the narration of the actions of Lady Capulet and how she helps complicate the conflict when she decides to hasten Juliet’s marriage to Paris

Read more about conflicts here:

https://brainly.com/question/26083560

#SPJ1

what is nanometer ??​

Answers

Answer: a nanometer is one billionth of a meter

0.000000001 m or [tex]10^{-9}[/tex]

Answer:

A measure of length in the metric system.

Explanation:

Nanometers are used to measure wavelengths of light and distances between atoms in molecules.

Read the excerpt from act 4, scene 3, of the tragedy of julius caesar. [brutus.] with this, she fell distraught, and, her attendants absent, swallowed fire. cassius. and died so? brutus. even so. cassius. o ye immortal gods! [enter lucius, with wine and taper] brutus. speak no more of her. give me a bowl of wine. in this i bury all unkindness, cassius. cassius. my heart is thirsty for that noble pledge. fill, lucius, till the wine o'erswell the cup; i cannot drink too much of brutus' love. [exit lucius. enter titinius, with messala] brutus. come in, titinius; welcome, good messala. now sit we close about this taper here, and call in question our necessities. cassius. portia, art thou gone? brutus. no more, i pray you. what moral dilemma does brutus confront in this excerpt?

Answers

Answer:  b

Explanation:

toot

Answer:

a

Explanation:

Brutus makes the choice to let go of his anger toward Cassius and forgive him.

Why is reverend parris so terrified by the events in salem? What possible result does he fear?

Answers

Answer:

Reverend Parris is scared that his reputation will be ruined as well as his livelihood.

Explanation:

"The Crucible" The Rev. Parris will do everything to safeguard his reputation and power. Reverend Parris worries that his rivals will destroy him despite his daughter's strange condition.

Jordan is a 22-month-old who is starting to utter two-word sentences. What is this called?

Answers

Answer:

telegraphic speech

Explanation:

The development of telegraphic speech normally occurs in the second year of a child's life. A two-word statement that expresses the primary idea of the sentence.

which of the following sentences is punctuated correctly?
A. That's of average interest to me!
B. Is that all you have to say!
C. That's awesome!
D. That's awesome?

Answers

The sentence that is punctuated correctly is:

C. That's awesome!What is punctuation?

Punctuation is the use of signs and symbols like the period, comma, apostrophe, question mark, etc., in sentences to make meanings clearer.

Punctuation was accurately used in sentence C because the apostrophe and exclamation fit into the provided words. "That's" is a short form of "That is" so the apostrophe was well used to separate these. Also, the exclamation mark showed a sense of excitement. This is a normal feeling when we are happy about something.

The other sentences do not make good use of punctuation marks. In the first sentence, there is no need for the exclamation mark. It could have simply ended with a period.

In the second sentence, a question mark should have been used and in the last option, a period instead of a question mark would have been more appropriate.

Learn more about punctuations here:

https://brainly.com/question/92653

#SPJ1

What is the purpose of the research process (usmc) basic grammar and composition

Answers

The purpose of the research process (usmc) basic grammar and composition is to help in engaging with the right use of vocabulary and punctuation and create a good flow of content.

Because in order to put your creative ideas into action, you have to have good written and spoken communication skills. It helps you become knowledgeable about the topic, problem.

Putting your thoughts into writing regarding this study enables you to construct a logical argument or argument that your readers can understand and take action on. Thus, the purpose of the research process (usmc) basic grammar and composition is to help in engaging with the right use of vocabulary and punctuation and create a good flow of content.

To know more about research process:

https://brainly.com/question/1173306

#SPJ4

Read the excerpt from paragraph 5 of "How Theseus Lifted the Stone."

And Theseus went into the thicket, and stood over the stone, and tugged at it; and it moved. Then his spirit swelled within him, and he said, 'If I break my heart in my body, it shall up.' And he tugged at it once more, and lifted it, and rolled it over with a shout.

Which word reflects the same connotative meaning as the word swelled in the sentence?

A.
expanded
B.
strengthened
C.
inflated
D.
developed

Answers

Answer: B

Explanation: i did it with my teacher

Strengthened reflects the same connotative meaning as the word swelled in the sentence. Thus, option B is correct.

What is a How Theseus Lifted the Stone?

The tale centers on a little child, the offspring of Aegeus's wife Aethra, who'd been destined to remove a boulder and establish his bloodline. To gain the right to rule, prince Arthur must successfully perform the job of retrieving a mystical weapon from a rock.

Connotative connotation or implying a supplementary or related interpretation in supplementary to the main meaning. The same is used for the connotative which means that the power will be divided. If the head will be broken just by the body. In this the person who removes the sword will be termed as strengthened or also called swelled.

Therefore, option B is the correct option.

Learn more about How Theseus Lifted the Stone, here:

https://brainly.com/question/28107393

#SPJ5

What was rule number three in “the great Greene heist”?

Answers

The rule number three in the novel or story titled "The Great Greene Heist" is: "there can be no conning done in the name of love"

What is the theme of "The Great Greene Heist"?

It should be noticed that "The Great Greene Heist" has a number of themes. Among them are:

Corruption of authority officialselectioneeringpolitical corruptionand the corrupting effect of money

In the tale, Jackson assembles a talented group of different young people to sabotage a potentially rigged student election.

In just three weeks, he comes up with seven ideas and gains Gaby's admiration.

Learn more about "The Great Greene Heist" at:
https://brainly.com/question/27974838
#SPJ1

What role did religion play in early American life?
O Settlers practiced religious freedom.
O Religion was only common among slaves.
O Communities revolved around the church.
O The work of the day did not allow for religion.

Answers

your answer is religion was only common among slaves.

Because the Earth is approximately 55 million kilometers
from Mars, and it would take a manned space craft almost
3 years to travel that distance, a trip to Mars is impractical.

This statement is an example of which type of rhetoric?

Answers

This statement is an example of:

Logos

What is Logos?

Logos is a form of rhetoric that uses logical reasoning to arrive at conclusions.

So when this passage used figures to support the main point being made, it was thus applying logos. Ethos and pathos are other examples of logos.

Learn more about logos here:

https://brainly.com/question/13118125

#SPJ1

​​Based on “The Myth of the War of the Worlds Panic,” what can readers determine about the survey conducted the night Welles’s broadcast aired?

Answers

The readers can infer that the majority of listeners believed the broadcast to be a joke.

Which word in the excerpt provides a definition for vittles?

Answers

The word in the excerpt which provides a definition for vittles is Food. Read more about excerpt

What is an excerpt?

An excerpt means to take a small part from a speech, book, film, etc. in order to publish it separately: This passage has been excerpted from the provided book novel.

Therefore, the correct answer is as given above.

The complete question goes thus:

Read the excerpt from The People Could Fly

B.r.u.h. Alligator think to heself, What this here? I never seen such animals before. But it's vittles! Food! And he grabs one, two

of the beagles and pulls them under the water. The other h.o.u.n.d. swum out of there, took he feet in the hands, and ripped on home.

Which word in the excerpt provides a definition for vittles?

Learn more about excerpt: https://brainly.com/question/21400963

#SPJ1

What are three things that make three a great story and how do they all tie together

Answers

Answer:to boil down to three fundamental elements: character, setting, and plot or Explain the context. Reveal emotions. They need to be real and relatable. Conflict

Explanation:Explain the context. Reveal emotions. They need to be real and relatable. Conflict: the lesson is often illustrated in how the character transforms through challenge

You can use endlessly different story structures and styles, but each story or novel Tie characters together by their love—or hatred—of someone or something else.

Which line uses an iambic meter?
OA. Wait for the morning! Ah! We wait indeed
OB. A battered swordsman, slashed and scarred
C. Nature, the gentlest mother of all
D. Wondrous cities with temples everywhere

Answers

Nature, the gentlest mother of all lines uses an iambic meter.

Option C. Nature, the gentlest mother of all.

Iambic is a poetic prosodic foot composed of two syllables. A non-strong syllable is followed by a strong syllable, pronounced duh-DUH. iambus can consist of a word with two syllables or two different words.

Iambic is his two-syllable poetry unit where the first syllable is not stressed and the second syllable is stressed. Words such as "reach," "express," and "explain" are all examples of strength patterns for non-strong and strong syllables.

If a pair of syllables is arranged such that a short note is followed by a long note or a non-bang followed by a strong pattern, the foot is said to be "weak".

Learn more about an iambic meter at

https://brainly.com/question/12292759

#SPJ1

what is a static character

Answers

Answer:

A static character does not take important change throughout the story, remaining essentially the same at the finish.

Explanation:

Consider these two arguments about immigration.

In a well-structured paragraph, compare the rhetorical devices used by President Obama and President Trump.

Answers

The rhetorical devices used by President Obama and President Trump has been given below in the paragraph.

Pathos and Logos are employed in President Barack Obama's immigration argument. Pathos may be shown when he tries to elicit feelings of sympathy, shame, and empathy from the audience for those families who come to the United States and experience problems such as prejudice. He's attempting to elicit particular emotions by discussing the challenges and sorrows of those families. He's making use of a psychological resource. When he speaks about realities, such as the reality that racism still exists in the United States and that immigrants are a part of the American community, Logos is visible. He bases his argument on logic and evidence.

Pathos, Ethos, and Logos are all employed in President Donald Trump's immigration argument. When he tries to communicate feelings of grief and pity for American families who lose their employment as a result of immigrants taking American jobs, he uses pathos. He tries to express his views about the difficulties that Americans suffer in comparison to the plight of immigrants. The word logos appear in the last sentence. The citizens of the United States are our responsibility to serve, protect, and defend. He employs reasoning to persuade the audience, attempting to persuade them that his statement is ethically correct and hence logical. The word ethos appears in both the last and first phrases. He uses his power to persuade others that his viewpoint is correct.

Learn more about immigration at

brainly.com/question/24475673

#SPJ1

picture shows everything. thanks!

Answers

Answer:

direction

Explanation

hope this helps

An author fictionalizing a story should use which types of source materials to research the story's elements? Select
3 options.
O interviews
O movies
O news articles
short stories
D textbooks

Answers

Correct answers
—-interviews
—-new articles
—-textbook

Match each word with its definition.
1.
deliberate
2.
validity
3.
interpretation
4.
negate
5.
dispute
6.
refute
7.
fallacy
8.
rebuttal
9.
affirm
10.
credibility
a.
using information that is incorrect
b.
state something strongly as a fact
c.
prove that something is wrong
d.
a disagreement or argument
e.
think about the pros and cons carefully
f.
being logical, accurate, and factual
g.
an opposing argument
h.
the act of explaining the meaning of something
i.
show that a statement is ineffective or false
j.
the reputation of being trusted or believed in
16

Answers

Words:

DeliberateValidity InterpretationnegateDisputeRefuteFallacyRebuttalAffirmCredibility

I will give a brief explanation of each word, which will then help us reach the final answer.

Deliberate. Completes an action with purpose, well thought out.Validity. Root word being valid, which means to be proven to be correct. Validity means to question the integrity of the "correctness". Interpretation. An individuals' thought processes, ideas, and opinions of a subject. Negate. To hinder or cease. Dispute. Argue against with the intent to cancel.Refute. To Invalidate. Fallacy. A misconception founded without evidence.Rebuttal. A counterargument. Affirm. Certified as or guaranteed to be true. Credibility. Proof that information is true.

With my definitions in mind, the matching words and definitions are:

Deliberate - h. The act of explaining the meaning of something.Validity - e. Think about the pros and cons carefully.Interpretation - f. Being logical, accurate, and factual.Negate - i. Show that a statement is ineffective or false. Dispute - d. A disagreement or argument. Refute - c. Prove that something is wrong.Fallacy - a. Using information that is incorrect.Rebuttal - g. An opposing argument.Affirm - b. State something strongly as a fact. Credibility - j. The reputation of being trusted or believed in.

Type the past tense form of the verb in this sentence. The boys race for the finish line.​

Answers

Answer:

The boys raced for the finish line

The boys raced for the finish line.

What is the main point of James Green's "Equal Pay Bill" letter?

Answers

Answer: women do not deserve equal pay for equal work because men are the breadwinners and women should be at home raising children.

Explanation:

What does the protagonist want? Provide at least two specific details from the text to support your analysis of the protagonist's motivation or goal. about hamadi please hellp. i'll give who ever answers frst to this question a big huge brainliest.

Answers

We can actually deduce here that the protagonist wants to fill the emotional and physical emptiness he feels.

The main motivation of the protagonist that can be inferred here that the protagonist wants to satisfy the emptiness he feels inside.

Who is a protagonist?

A protagonist actually refers to the main character seen in a story or in a play. The protagonist is actually opposed by an antagonist. The antagonist is usually the opposing character in a story.

Thus, we can actually see here that in "Condensed Milk" the protagonist is known to be a prisoner who lived in terrible conditions. He is forced to work and usually given little food. This question is related to "Condensed Milk".

Learn more about protagonist on https://brainly.com/question/532326

#SPJ1

What is the centrial idea bright city lights are keeping ocean predators awake and hungry

Answers

Increased light levels in marine habitats, associated with large coastal cities, can significantly change predator-prey dynamics is the central idea bright city lights are keeping ocean predators awake and hungry.

What is the central idea bright city lights are keeping ocean predators awake and hungry?

In one of the pioneering studies of its sort, we discovered that higher light levels in marine ecosystems, which are connected to sizable coastal cities, can drastically alter predator-prey dynamics. The day-night cycle of some fish is shifting due to light pollution, which has a significant impact on how they feed. Some of these predators vanished when the lights came on, while others feasted on the illuminated underwater buffet. Overall, when the night waters were lighted, there was substantially more predation on populations of seabed organisms. Some of these predators vanished when the lights came on, while others feasted on the illuminated underwater buffet. We spied on these groups and documented how their behavior altered using a combination of underwater video and sonar. The animals in our study slowed down at night, just like we do. Predators fish lost their appetite and grew sluggish. Large coastal towns' increased light pollution can drastically alter the dynamics of predator-prey relationships in ocean environments.

Learn more about central idea bright city lights here:

https://brainly.com/question/13838171

#SPJ4

Other Questions
which represents the most visible and authoritative voice of the company and reflects its core values? Which of the following best describes the purpose of the White Wolf movement in China?A peasant uprising meant to rid the countryside of Christian missionariesA communist party initiative to radicalize peasantsChiang Kai-shek's plan to instill moral purpose and discipline in the Chinese publicA peasant-supported band of armed men who robbed the rich to give to the poor to restore justice sherrington concluded that the cortex had an inhibitory effect on reflexes because 14. (05.07 LC)In this segment, you learned that writers changeelements of a play (setting, characters, theme,dialogue) when creating modern adaptations.Choose one play element and write two to threecomplete sentences to explain how it might bechanged. (10 points) the stringbuilder class's insert method allows you to insert a(n) ________ into the calling object's string. Using your knowledge of historical context, which lines illustrate what happened to Yuba City afterthe gold rush?- Alas, that beauty thus should fade, / Or live so unregarded!- The Feather River at thy feet,/ The lofty Buttes behind thee.- I've seen her at the morning prime-/The sky looked sweeter, bluer!- What has she said, or done, to be / Thus doomed, and thus deserted? all of the following are popular architectures for master data management except: group of answer choices identity registry. integration hub. persistent. normalization. some employees who do not take advantage of work-life balance options resent their coworkers who are more likely to use work-life programs T/F Two identical spaceships are moving through space both with speed v0. both spaceships experience a net force of magnitude f0 over the same time interval. for spaceship 1, the net force acts in the same direction as the spaceship is moving; for spaceship 2, the net force is directed opposite to the spaceships motion, causing spaceship 2 to slow down but not stop. for which spaceship, if either, does the kinetic energy change by a greater magnitude, and why? Compute an expression for P{,m max B(s) 41 x} 7. Let M = {maxx, x}. Condition on X(t1) to obtain P(M) = PMXt) = y) 1 V2f, y? According to JP Morgan, the following factors determine your risk tolerance: your time horizon, your goals, & your 'risk appetite'.TrueFalse melvin borrowed $1,200 for furniture. his monthly payments were $60 for 24 the total amount repaid.A. $240B. $1,200C. $1,440D. $2,880 Write an E20 assembly language program that will store the value 1099 at memory cell 456, then halt. Make sure that your program is correct and can be assembled. Who owned American land first URGENT!!!!!! Think about a situation of division that would benefit from increased unityPlease give me a few different options to choose from. Thank you! write a statement that opens a file customers.dat as a random access file for both reading and writing. the created object should be fstream. part 1: let x and y be two independent random variables with iden- tical geometric distributions. find the convolution of their marginal distributions. what are you really looking for here?1 Costco buys a Euro put option (contract size: 125,000) at a premium of $0.13/. The exercise price is $1.18/: If the spot at expiration is $1.08/, what is the Costco's profit? $3,750 loss O $16,250 loss O $12,500 loss $28,750 loss The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right.I. Which end of the DNA template is 5 and which end is 3?II. Give the sequence and identify the 5 and 3 ends of the RNA transcribed from this template. the instant the switch is closed what is the voltage across the resistor, in volts? rl switch circuit select one: a. 0 b. 20 c. 40 d. 2