How does specialization improved productivity

Answers

Answer 1

Specialization increased output in the following ways:

(A) Due to the division of labor among them, workers are able to concentrate on a small number of or even just one task.

What is specialization?

A South American corporation picking bananas is an example of how specialization includes concentrating on a certain skill, activity, or industrial process to become the leader or expert.

Economies of scale are a result of specialization.

Trade benefits from specialization since it benefits both parties to trade agreements.

Both countries will be able to boost the overall output in their respective countries while also saving time and resources.

The following ways specialization boosted output:

(A) Workers are able to concentrate on a few or even one task because labor is distributed among them.

(B) They become more proficient at a task the more they concentrate on it, which reduces the time and cost necessary to produce a good.

Therefore, specialization increased output in the following ways:

(A) Due to the division of labor among them, workers are able to concentrate on a small number of or even just one task.

(B) The more people focus, the better they get at a task, which cuts down on the time and expense needed to manufacture a good.

Know more about specialization here:

https://brainly.com/question/24448534

#SPJ1


Related Questions

Your senses are unable to attend to every stimulus in the environment at the same time. True False.

Answers

Your senses are unable to attend to every stimulus in the environment at the same time is true.

What are the senses we use to respond to environmental stimuli?

Five distinct senses are present in humans: olfaction (smell), gustation (taste), equilibrium (balance and position), vision, and hearing. We also have what is known as general senses, or somatosensorial, which are sensitive to stimuli including temperature, pain, pressure, and vibration. Our brains combine and analyze the various pieces of information each sense sends to us.

Sensory receptors pick up on sensory stimuli change to cause a sensation. Sensory receptors are located all over the body and detect sensory stimuli. Information is communicated to the brain by the receptors. The brain is similar to a computer, with thousands of cables connecting different parts of it, allowing us to process, decipher, and then decide on the best way to respond to sensory stimuli.

To learn more about stimulus, visit:

https://brainly.com/question/28388693

#SPJ4

What are 3 negative aspects of an online community?

Answers

There are a few drawbacks that might affect people who participate in online communities. For instance, those who are unable to communicate face-to-face may start to have a lot of mental health problems.

Successful online communities have a goal and a culture, much like real-world groups do. Boy Scouts and Burning Man are extremely dissimilar organizations. Compared to Tumblr, Reddit is very different. When two groups of individuals interact frequently, cultural signifiers such as inside jokes, specialized language, local customs, and the like begin to emerge. We are able to communicate with one another and understand every social indication that is being described in this way. For example, when COVID first began and people were unable to visit their family, it undoubtedly caused a great deal of stress and misery because people couldn't be with their loved ones, especially those who were seriously ill. We are not getting the same interaction by talking to them on the phone or going online every day. According to studies, "Internet use was also connected with increases in loneliness and depression." The internet can be useful at times, but it's not always the best tool for us to use because it can create a lot of turmoil.

To learn more about online communities please click on below link

https://brainly.com/question/28239814

#SPJ4

you arrive at the scene of a call and find an unconscious adult victim with a pulse. the first ventilation is unsuccessful. the next step should be to

Answers

As you arrive at the scene of a call and find an unconscious adult victim with a pulse, if the first ventilation is unsuccessful, the next step should be to reposition the head.

Unconsciousness refers to the state when a person is unable to respond to people and activities. Unconsciousness can be caused by a variety of reasons such as an accident, blow to the heat or chest, severe blood loss, drug overdose, poisoning, etc. When encountered when an unconscious person, the first step is to check for person’s airway, breathing, and circulation. The first step taken by emergency respondents is bag-mask ventilation with supplemental oxygen. If that is unsuccessful, the next step is to reposition the head to clear breathing pathway.

Learn more about Unconscious person:

https://brainly.com/question/2684784

#SPJ4

explain why robert clive was successful in battle of plassey ?(7)

Answers

BATTLE OF PLASSEY

The Battle of Plassey in 1757 was a key event in the history of India, as it marked the beginning of British colonization of the country. Robert Clive, a British military officer, played a crucial role in the victory of the British East India Company over the Nawab of Bengal, Siraj-ud-Daulah.

There are a few reasons why Clive was successful in the Battle of Plassey:

Military strategy: Clive employed a number of tactical maneuvers during the battle, including dividing his forces and attacking from multiple directions, which helped to confuse and overwhelm the enemy.

Use of native allies: Clive was able to secure the support of several key native allies, including the Mir Jafar, the Nawab of Bengal's own commander-in-chief, who helped to undermine the Nawab's forces from within.

Superior weaponry: The British East India Company had access to better weapons and equipment, including cannons and muskets, which gave them a significant advantage over the Nawab's forces.

Tactical use of terrain: Clive was able to choose a battlefield that was favorable to his forces and used the surrounding landscape to his advantage.

To conclude, Clive's military expertise and strategic planning played a major role in the British victory at the Battle of Plassey.

Hope This Helps You!

witch of thr following team members would be tasked with using sales or pruduction information to determine transportation requirements

Answers

The transportation manager is in charge of determining the team's transportation needs.

What is transportation?

The purposeful movement of goods, people, and animals between two locations is known as transportation. There are many different types of transportation, including air, land (train and road), water, cable, pipeline, and space. Transportation infrastructure consists of both fixed structures, such as highways, railroads, planes, waterways, canals, and pipelines, as well as terminals, such as seaports, railroad stations, bus stops, warehouses, trucking terminals, and airports. In addition to the exchange of persons and goods, terminals can also be utilized for maintenance. Any of the several types of infrastructure for moving people or things are referred to as means of transportation. Among them may be vehicles, riding animals, and pack animals. Examples of vehicles include wagons, automobiles, bicycles, buses, trains, trucks, helicopters, boats, spaceships, and airplanes.

To learn about infrastructure, visit:

https://brainly.com/question/14302325

#SPJ4

A drive-reduction theorist was taking a walk when he came across a hiker resting against the base of a tree. How would the theorist explain the hiker's nap

Answers

Although responses may differ, they should all contain one or more of the following details: According to the theory of drive-reduction, we have needs, such as the need for sleep.

This activate drives (the need for sleep manifests as weariness or tiredness), which motivate us to act in a certain way to relieve the drives (which would be getting rest or sleeping).

One important behavioralist theory of learning is drive reduction theory. It asserts that organisms are driven to weaken their urges to preserve homeostasis. Any internal state that propels an organism to meet a need is referred to in this context as a drive. The fundamental tenet of drive-reduction theory is that all human behavior is driven primarily by a desire to lessen one's "drives."

Learn more about drive-reduction theory here:

https://brainly.com/question/3246177

#SPJ4

How would you describe the social difference between Tevye and the two women whom he met in the forest

Answers

Answer:

"Tevye and the Fiddler" is a novel by Sholem Aleichem which tells the story of a poor milkman named Tevye, his family and community, as they try to survive and preserve their traditions in the face of poverty, anti-Semitism and other challenges. I am assuming you are referring to the stage adaptation of this story, "Fiddler on the Roof" which is a musical.

The two women whom Tevye met in the forest are the fiddler, who is a non-Jewish, traveling musician, and the matchmaker, Yente, who is a member of the Jewish community.

Tevye, is a traditionalist, who believes in the importance of preserving his family's traditions and customs and follows the rules of his faith, He is a poor milkman, who is also the father of five daughters and the head of his household.

The fiddler, on the other hand, represents the outside world and the idea of change and breaking with tradition. He is not Jewish, does not follow the same customs as Tevye, and is a wanderer, not tied to any one place or community. He represents the idea of freedom and individuality.

Yente, the matchmaker, is a member of the Jewish community, but she is seen as the embodiment of conventional thinking and the status quo. She is a person who arranges marriages and is not opposed to arranged marriages, and she is a person who follows the traditions closely, but lacks compassion and is focused on getting a good match.

In summary, Tevye, the fiddler and Yente, represent different aspects of Jewish society in pre-revolutionary Russia. Tevye represents the traditional values, customs and the struggle to preserve them, while the fiddler represents the outside influence and the idea of change.

If you were a newspaper reporter, what would you write about globalization in the UAE?

Answers

As a newspaper reporter, I would write about the ways in which globalization has impacted the United Arab Emirates (UAE). The UAE has a long history of trade and commerce, and globalization has played a significant role in its development as a major hub for international business and tourism.

One aspect of globalization that I would focus on is the country's rapid economic growth and modernization. The UAE has seen tremendous growth in recent decades, and this has been fueled in large part by foreign investment and the influx of international businesses. This growth has brought with it many benefits, including an increase in job opportunities and an improved standard of living for many residents. However, it has also led to some challenges, such as rising costs of living and the need to adapt to a more diverse and rapidly changing society.

Another aspect of globalization that I would explore is the cultural exchange that has taken place in the UAE as a result of increased international travel and migration. The country is home to a diverse population of expatriates from around the world, and this has led to the blending of different cultures and traditions. This cultural exchange can have both positive and negative effects, and I would aim to explore both sides of the issue in my article.

Finally, I would examine the role of the UAE in the global economy, particularly as a hub for trade and logistics. The country's strategic location at the crossroads of Europe, Asia, and Africa has made it a key player in the global economy, and I would examine the ways in which this has benefited the country and its citizens, as well as any challenges it has faced as a result.

To learn more about globalization:

brainly.com/question/17863739

Answer: in my opinion the impact of globalization on media has its own advantages and disadvantages. Ever since mass media came into existence companies have used this as a means to communicate to let a large no. of people aware about products.

Explanation: The effects of globalization are diverse, affecting the various aspects of the world so as to bring changes for better. its effects not just influence the financial conditions of the country but also affects the industrial sector and the culture of the countries involved. Globalization widens the access to a range of foreign supplies for the consumption of a large number of consumers, owing to the market planning and policies adopted by different corporations.

Media refers to the different means of communication like radio, television, internet etc. it plays a very important role in shaping human mind. Mass media is a section of the media determined to reach a greater audience.

ou always rattle the box of dog biscuits before giving your dog a treat. As you do so, your dog salivates. Rattling the box is a(n) ________; your dog's salivation is a(n) ________.

Answers

Before giving your dog a reward, you always shake the dog biscuit box. Your dog drools as you do this. Your dog's salivation is a conditioned response (CR) to the rattling of the box, which is a conditioned stimulus (CS).

The conditioned stimulus (CS) in classical conditioning is initially neutral and eventually elicits a conditioned response (CR) resembling the unconditioned response elicited by the unconditioned stimulus that has been repeatedly matched with the conditioned stimulus (CS).

According to the terminology of the classical conditioning paradigm, the conditioned stimulus (CS) is a learnt input that could potentially result in a conditioned response. For instance, the sound of a bell serves as the conditioned stimulus in Pavlov's experiment, and the dogs' conditioned reaction is to salivate.

To learn more about conditioned stimulus (CS), please refer:

https://brainly.com/question/14886707

#SPJ4

What was the effect of the Tuskegee Airmen?

Answers

The Tuskegee Airmen were the first batch of African American soldiers who successfully completed their training and entered the Army Air Corps. They were almost 1000 America's African aviators who were inducted in US Military.

Tuskegee Airmen had following effects-

Their success proved to the American general public that if African Americans where given the opportunity then they could become effective military leaders and pilots. There dedication and determination moved the general public of America.The struggle of Tuskegee Airmen reflects that the African Americans had work very hard to achieve equal rights. They worked not only through legal attacks on the system of segregation, but they also used the techniques of nonviolent direct action aimed at segregation in the military.

To know more about Tuskegee Airmen refer to-

brainly.com/question/25561215#

#SPJ4

When the Lt. Governor and Speaker have disagreements, it can have serious consequences for the legislative process. What proposed law divided Speaker Joe Straus and Lt. Governor Dan Patrick in 2017

Answers

Texas Lt. Governor Dan Patrick and Speaker Joe Straus disagreed over the proposed "bathroom law" in 2017. The legislation, also known as Senate Bill 6 (SB 6), would have mandated that people use toilets in public institutions like colleges, government offices, and schools based on "biological sex" rather than gender identification.

Speaker Joe Straus vehemently opposed Lt. Governor Dan Patrick's plan because he was worried about the harm it would do to transgender people as well as the economic effects it would have on the state.

The bill ultimately failed to pass, after a special session of the Texas legislature was called to consider it.

The proposed "bathroom bill" in Texas was a contentious issue that received significant media attention. The bill would have required individuals to use bathrooms in public schools, government buildings, and public universities based on "biological sex" rather than gender identity.

To learn more about legislation

https://brainly.com/question/29804648

#SPJ4

Which of the following is NOT an emotional reward commonly associated with close relationships:
a. comfort
b. happiness
c. emotional continuity
d. empathy

Answers

Answer: C Emotional Continuity

Explanation:

Comfort, happiness and empathy all generally occur after having a long-term close relationship. Empathy occurs after being around them for a while because you easily start to understand the person from the close relationship, comfort obviously occurs when a close bond is formed, and happiness comes from relationships as well. So the only odd one out is emotional continuity.

A teacher of students from various socioeconomic backgrounds is teaching financial literacy. Which of the following strategies is best for reaching all of the students in the class

Answers

Students should make budgets based on various, arbitrary income levels and report their findings with the class.All students can participate in the learning process using this approach, which also helps them apply what they learn in class to circumstances they will probably face in real life.

A person's ability to make wise decisions with all of their financial resources is based on their level of financial literacy, which is the set of abilities and knowledge they possess.A person who understands money, for instance, knows that they cannot spend more than $2,000 per month without becoming debt if they earn $2,000 per month. A person with more financial literacy may be aware that they ought to set aside portion of that $2,000 for the future.In order to be financially literate, one must pay off debt, make a budget, and comprehend the differences between various financial products. In conclusion, families that are attempting to balance their budgets, buy a home, pay for their children's education, or secure an income in retirement are significantly impacted by financial literacy.

To know more about Financial literacy here

https://brainly.com/question/13102912

#SPJ4

Why do nations often impose trade restrictions that make it difficult for its citizens to trade with people in another country?

Answers

The main goal of trade restrictions is to shield domestic businesses and workers from competition from foreign businesses. The importation of goods and services made in other nations is restricted under a protectionist policy.

Why do nations frequently impose trade restrictions that make it harder for their citizens to conduct business with persons in other countries quillet?

Trade restrictions frequently benefit very apparent special interest groups while harming the wider public in a less obvious way.

What might cause a country to desire to stifle trade?

The government will impose trade restrictions to support the growth of home industry if they are unable to compete with international industries. Governments may also impose trade restrictions to support domestic business rather than promoting corporate exports.

What are the top three justifications for import trade restrictions?

There are several reasons why governments might decide to apply tariffs, including the following:

to strengthen national defense initiatives.

to encourage domestic job opportunities.

to oppose trade policies that are aggressive.

to safeguard the environment

To Know more about protectionist policy.

https://brainly.com/question/4659538

#SPJ4

What was Korematsu's argument?

Answers

Korematsu used to be arrested and convicted of violating the order. He responded by way of arguing that Executive Order 9066 violated the Fifth Amendment of the Constitution

because habeas corpus had no longer been suspended, and his right to libery used to be being infringed with the aid of army action without due method of law.

What was Korematsu struggle for?

the civil rights of all Americans

Fred Korematsu continued to battle for the civil rights of all Americans. He lobbied in Congress to omit the Civil Liberties Act of 1988. This act gave a public apology and compensation to Japanese Americans who had been incarcerated. In 1998, Korematsu used to be awarded the Presidential Medal of Freedom.15-Sept-2021

Learn more about Korematsu  here:

https://brainly.com/question/3552660#SPJ4

Which are subatomic particles? (Select all that apply.)
A. protons
B. nucleus
C. electrons
D. neutrons
First Answer gets brainliest!

Answers

Answer:

They are protons and electrons

protons, electrons, and neutrons.

What foreign powers have ruled Spain and Portugal?

Answers

Answer: the answer is ⬇️down there

Explanation: Portugal–Spain relations describes relations between the governments of the Portuguese Republic and the Kingdom of Spain. The two states make up the vast majority of the Iberian Peninsula and as such, the relationship between the two is sometimes known as Iberian relations.ion:

Answer: between 1580 and 1649 Astec union between the crowds of Castile, and aragon in the kingdom of Portugal brought the entire Liberian peninsula as well as Portuguese in Spanish overseas possessions under the control of the Spanish Habsburg monarchs Philip II, Philip III, and Philip IV, this union is referred to as the Iberian Union

How much interest
accumulates annually on our
federal debt?
A. $300 Billion
B. $300 Trillion
C. $300 Million

Answers

Answer:

B. $300 Trillion

Answer:

A

Explanation:

Its usually around 400 Billion, but that wasn't really an option. This right here is unnecessary info, and I added this because it wouldn't let me simply post "A".

George: A well-known educator claims that children who are read to when they are very young are more likely to enjoy reading

Answers

George: According to a renowned educator, young children who are read to frequently are more likely to like reading as adults than children who are not read to frequently. But this assertion is obviously untrue.

What advantage does reading aloud to kids have over not reading at all?

Here are some suggestions on how to give your child the best start possible. Children who read for pleasure on a regular basis not only score better on reading exams than their peers, but they also expand their vocabulary, acquire more general knowledge, and develop a greater understanding for different cultures.

What keeps kids from developing a passion for reading?

Some of the main causes of reading difficulty in children include the child's socioeconomic background, physical anomalies, mental and psychological imbalances, the child's curiosity, familiarity with symbols, and the teacher's ability to facilitate student learning.

Learn more about reading: https://brainly.com/question/15315297

#SPJ4

the name of 3 countries that have "Republic" as their system of government

Answers

Answer:

The United States, Mexico, India, France, Kenya, South Korea, Peru, and Indonesia

Explanation:

are only a few of the world's many true republics.

Answer:

France, Kenya, South Korea

Explanation:

Was there any positive impact of the British rule in India?

Answers

The development of the railways and the widespread use of the post and telegraph systems were some benefits of British administration in India.

What is administration?

Depending on the legal system it operates under, the word "administration" has different connotations when used in regard to the government. A generic decision-making body is one approach to conceptualize administration. It can also refer to an executive branch organization led by an administrator, like the National Aeronautics and Space Administration, Archives and Records Administration, or Small Business Administration (NASA). Historically, presidential systems of governance have referred to the executive branch as the "administration." The term "administration" has several different connotations in Europe, although it is most frequently used to refer to managerial tasks in general, such as those carried out by municipal governments or the national and local government system that governs a town or region.

To learn about administration, visit:

https://brainly.com/question/29915306

#SPJ4

bloggers have been successful in fact-checking news stories from big media outlets.
a. true
b. false

Answers

The statement "Bloggers have been successful in fact-checking news stories from big media outlets." is true.

Give a brief account on blogs.

A conversation or informational website published on the World Wide Web that consists of brief, typically informal text entries in the style of a diary is called a blog (a contraction of "weblog") (posts). The most recent post usually shows up first at the top of the web page when posts are shown in reverse chronological order. In 1994, Justin Hall, a college student, became the first person to blog on the internet. Links.net was that website, and it is still operational today. Before 2009, blogs were typically the creation of a single person, occasionally of a small group, and frequently covered a specific topic. "Multi-author blogs" (MABs), which contain the writing of several authors and are occasionally professionally edited, started to appear in the 2010s.

The majority of blog traffic is now coming from MABs from publications including newspapers, other media, universities, think tanks, advocacy groups, and similar organisations. MABs and single-author blogs are increasingly being included into the news media thanks to the growth "microblogging" platforms. Adding or maintaining content to a blog is also possible with the verb blog.

To know more about, blogs, visit :

https://brainly.com/question/14649220

#SPJ4

"Bloggers are successful in fact-checking news from major news outlets" is a true statement.

Provide a short blog report.

Conversational or informational websites consisting of short, usually informal, journal-style text entries published on the World Wide Web are blogs (short for "weblog") (posts) and called. When you view posts in reverse chronological order, the newest posts usually appear first at the top of her web page. In 1994, college student Justin Hall created the first blog on the Internet.

Links.net is that site on internet, which is still in operation today. Prior to 2009, blogs were generally written by one person, sometimes by a small group of people, and often focused on a specific topic. Since the 2010s, so-called “multi-author blogs” (MAB) have emerged. This blog contains a text by multiple authors and may be professionally edited. Most of the blog traffic now comes from his MAB from publications such as newspapers, other media, universities, think tanks, advocacy groups, and similar organizations.

To know more about internet, visit:

https://brainly.com/question/28586366

#SPJ4

The process by which citizens take their political cues from more well-informed opinion leaders is known as ______.

Answers

The process by which citizens take their political cues from more well-informed opinion leaders is known as the information flow in two steps.

According to the text, the current process of political socialization in the United States enables us to support and obey the existing political system. The process by which we learn our political orientations and loyalties is called political adherence.Public opinion should matter because the legitimacy of a democracy is based on the idea that the government exists to serve the interests of its citizens and the public.There is an understandable temptation among disaster management agencies to create new structures for disaster preparedness response,but unless the agency.He argues that the success or failure of social movements is affected primarily by political opportunities.A process is a series of progressive and interdependent steps by which an end is attained.

To learn more about information flow please click on below link.

https://brainly.com/question/9573742.

#SPJ4

Sharon wants to talk to her teenage daughter about the dangers of smoking. Which of the following suggestions is least likely to persuade sharon

Answers

The suggestion of telling Sharon that she is forbidden to smoke, and at the same time giving her threats about taking the car away from her if she ever smokes, is the one that is least likely to persuade Sharon.

The technique of persuasion is to make an individual believe in one's own ideologies and beliefs through convincing the person in a way that the person comes to the stage of doing or abstain from doing an activity as a regular practice. The above case is similar, and the person will not persuade smoking, as she will have the fear of her car being taken away.

Learn more about persuasion here:

https://brainly.com/question/15157593

#SPJ4

When composing important or controversial communications, you should spend time evaluating the best way Multiple choice question. to maintain appearances. to be fair. to be forceful. slanting the facts.

Answers

When writing significant or contentious messages, you should take the time to consider how to be fair. The right response in this case is option B.

"Controversial communications" refers to any form of communication that is likely to be met with strong opposition or debate. This can include statements, ideas, or actions that are considered divisive, offensive, or otherwise likely to provoke strong reactions.

Examples of controversial communications might include statements about sensitive political or social issues, hate speech, or accusations of misconduct or wrongdoing.

Controversial communications can take many forms, including written statements, verbal statements, visual images, or other forms of expression. They can be made in a variety of settings, including online forums, social media, or in person. Controversial communications can also be made by individuals, groups, or organizations, and can be directed at a wide range of audiences.

Complete question:

When composing important or controversial communications, you should spend time evaluating the best way...

A. To maintain appearances.

B. To be fair.

C. To be forceful.

D. Slanting the facts.

To learn more about controversial communications

https://brainly.com/question/28556569

#SPJ4

Order the schools of thought in the behavioral viewpoint from earliest to most recent.
1. early behaviorism, human relations movement, scientific management
2. operations management, human relations movement, MBO phase
3. early behaviorism, human relations movement, behavioral science
4. early behaviorism, industrial, human relations movement
5. early behaviorism, human relations movement, administrative phase

Answers

Early behaviorism, human relations movement, behavioral science is the schools of thought in the behavioral viewpoint from earliest to most recent.

Which academic fields fall under the umbrella of behavioral science?

Economics, sociology, anthropology, and psychology are all branches of behavioral science. Economics, anthropology, sociology, psychology, political science, and biology inasmuch as it pertains to animal and human behavior are all included in the behavioral sciences. The researchers came to the conclusion that although improvements in the workplace may affect productivity, such advantages would only last temporarily. Anthropology is one of the fields that falls under the umbrella term of behavioral science. Economics with behavior. psychology of the mind. Three perspectives are included in the historical perspective (1911–1955): the classical, behavioral, and quantitative.

To learn more about behavioral science refer to:

brainly.com/question/2264149

#SPJ4

According to the Young-Helmholtz theory, when red-, green-, and blue-sensitive cones are all stimulated simultaneously, a person should see:

Answers

According to the Young Helmholtz theory, when red-, green-, and blue-sensitive cones are all stimulated simultaneously, a person should see some evidence that some cones are especially sensitive light is most directly supportive.

The young Helmholtz theory states that within our tiny eye cells that can receive waves of light and translate them into one of three colors that are green, red and blue and combining these three colors to create the entire visible spectrum of light as we see it.

The young Helmholtz theory of color vision is the combined stimulation of these elements that perception of other colors arises in which absence or deficiency of any one of these elements results to inability to misperception of any other color of which it forms a part.

Learn more about Helmholtz theory click on the link here:

https://brainly.com/question/14486447

#SPJ4

The cross-sectional method:
A) compares people of different ages with one another.
B) studies the same group of people at different times.
C) tends to paint too favorable a picture of the effects of aging on intelligence.
D) is more appropriate than the longitudinal method for studying intellectual change over the life span.

Answers

Option (a), The cross-sectional approach contrasts individuals of various ages.

What is a cross-sectional study's comparison?

A cross-sectional study stands out for its capacity to contrast numerous demographic subgroups at a certain moment. Think of it as snapping a photo. To draw inferences, whatever fits within the frame is employed.

What is involved in the cross-sectional research strategy?

A cross-sectional study is a type of research design in which information is obtained at one specific time from a broad range of people. Variables are observed in cross-sectional research without being altered.

Why do cross-sectional studies perform most effectively?

Early evidence of a causal relationship can be established with the aid of cross-sectional descriptive/analytical studies. These studies can also be utilized to look into the connection between exposure and the onset of chronic conditions for which there is no documented starting point.

Learn more about cross-sectional approach: https://brainly.com/question/14566469

#SPJ4

_____ is the process of interpreting and understanding one's environment. 1.Adaptation, 2.Transduction, 3.Perception, 4.Sensation

Answers

Perception is the process of interpreting and understanding one's environment. Thus, option (3) is considered as the relevant choice of answer.

Give a brief account on perception.

Our sensory perception of the outside environment is known as perception. We discover knowledge about our surroundings through this experience. Our ability to see things depends on the cognitive processes we employ to interpret information, such as using memory to recognize a friend's face or smelling a perfume we are familiar with. We are able to recognize environmental stimuli and react to them thanks to the perception process. Touch, sight, sound, smell, and taste are among the five senses that make up perception. The term "proprioception" refers to a group of senses that let us recognize changes in bodily posture and movement. At any given time, a lot of stimuli are all around us. By acting as a filter, perception enables us to interact with and make sense of the world without being overrun by the amount of inputs.

To know more about, perception, visit :

https://brainly.com/question/29765108

#SPJ4

What was life like in the internment camps?

Answers

The only furniture in the uninsulated barracks for interns was cots and coal-burning stoves. Common washing and restroom facilities were utilized by the residents, but hot water was frequently scarce.

What conditions existed in internment camps for Japanese Americans?

Japanese American internment camps have basic living conditions with little amenities. Armed guards guarded the barbed-wire-enclosed camps, which had isolated incidents of internment-related deaths. However, on general, camps were managed decently.

How did World War II internment camps look like?

In the "relocation centers" (also known as "internment camps"), four to five families with minimal amounts of clothing and belongings shared army-style barracks covered in tar paper.  The majority endured terrible conditions for at least three years before the war came to an end.

To Know more about  perimeter

https://brainly.com/question/6465134

#SPJ4

Other Questions
Termination of the postsynaptic potential would be expected from a drug or process that acts to a. blocks transport of the neurotransmitter molecule through the axon membrane. b. enzymatically degrade the neurotransmitter molecule. c. increase the number of postsynaptic receptors. d. increase release of the neurotransmitter. e. increase synthesis of the neurotransmitter molecule. When two lines make an angle of 90 degree is known as? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Helllllp please ???? Which of the following occurs when a person reaches the age of majority and states, either orally or in writing, that he or she intends to be bound by the contact entered into as a minor?Multiple ChoiceDisaffirmanceImplied novationImplied ratificationExpress novationExpress ratification What is the area of equilateral having side 12 cm? What is the value FG? solve the equation a^2x^2 = abx + 2b^2 using completing the square method Lupe wrote two different fractions with the same denominator. both fractions were less than 1. can their sum equal? can their sum be greater than 1? What number would you need to multiply the first equation by to eliminate the y variable when solving the system of equations by elimination? In three complete sentences, describe how i should find the solution to the system of equations below. -6x + 3y = -12x - y = 14 I have x N50 note and y N100 note. There are eight note altogether and their total value i N550. How many of each note do I have? What is the importance of mitosis for uni cellular organisms? Which sentence best describes how the setting contributes to the theme of appearance versus reality? If 16 inches of ribbon costs $2.08, how much will 36 inches ofribbon cost? Show your thinking. Use figurative language to describe each of your provided words. You will write one sentence for each word, and put the type of figurative language used in parentheses at the end of the sentence. Underline your word. Look at the example below to help you!The rainbow was a beautiful blanket, arching over the sky. (metaphor)clientadvertisementmemorizesidewaysexercisevarietyinquiresciencedialoguelibrary How is judicial activism connected to the idea of a loose interpretation of the US Constitution? ( x - 4 ) + ( 2x - 7 ) - find the Sum or Difference :) what was the main source of radio exposure for indie rock in the 1990s? In science, one example of a theory is the cell theory. If a scientist collects evidence that questions the basics of a scientific theory, this means the theory is