Holding your breath while ascending can lead to: Select one: A rupture of the tiny air sacks in the lungs, known as alveoli. A lung overpressure (overexpansion) injury. Arterial gas embolism (AGE). All of the above.

Answers

Answer 1

Holding your breath while ascending can lead to all of the above options.

Surfacing excessively fast or holding the breathing while swimming to the surface can make the air in the lungs expand which is known as pneumonic barotrauma. This might break lung tissue, which can prompt gas bubbles to be delivered into the blood vessel dissemination (arterial gas embolism).

The air in the lungs becomes risky when an individual ascends. On the off chance that somebody holds their breath while rising to the surface, the lungs and the air inside them extend as the water pressure decreases. Since that air has no place to escape, it continues to expand against the walls of the lungs, no matter what the organ's capacity.

Learn more about Swimming here,

https://brainly.com/question/17173961

#SPJ4


Related Questions

Which of the following statements is FALSE?
A. RNA is a single stranded molecule
B. RNA contains uracil
C. RNA is found only in the cytoplasm.
D. RNA contains ribose

Answers

Answer:

C

Explanation:

RNA is found mostly in the nucleus but can also be found in the cytoplasm, but it is not limited to it.

Which is an example of a ray-fin fish?
lungfish
O coelacanth
O shark
salmon

Answers

Explanation:

its showing all but salmon so im not sure,sorry, still trying

Answer: Salmon

Explanation:

bones

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Put "Allele Frequency" in a sentence

Answers

Answer:

With this data we can built a map of allele frequency and geographic location.

Answer: Here are a variety of sentences you could use...

1. Jensen was born with blue eyes because each of his parents gave him a recessive allele for the trait.

2. The dominant allele is the one that determines a physical characteristic or trait.  

3. Because Jill’s parents both gave her the dominant allele for curly hair, she has a wavy hair texture.

4. Which allele is responsible for blonde hair, the recessive allele or the dominant allele?  

5. On the other hand, the recessive allele is always overshadowed by its dominant partner.  

The EPA sets national air-quality standards for common air pollutants. The
data table shows the change in concentrations of these pollutants over time.
Emissions Reductions and Air Quality
Data period
Reduction
Pollutant
Improvement
(from/to)
in emissions (%) in air quality (%)
СО
69
85
Pb
99
98
1980 - 2014 NO,
55
60
0,
53
33
81
80
16
30
2000 - 2014
33
36
SO2
PM,
PM25
Which conclusion do the data support?

Answers

The data support the conclusion that reducing emissions leads to improvement in air quality for the common air pollutants monitored by the EPA.

What is EPA?

The Environmental Protection Agency (EPA) is a federal agency of the United States government that was established in 1970 to protect human health and the environment. The EPA's mission is to ensure that all Americans have clean air to breathe, clean water to drink, and safe land to live and work on. The agency is responsible for setting and enforcing national standards for air and water quality, as well as for managing toxic waste and other pollutants.

The EPA also works with other federal agencies, states, tribes, and local governments to address environmental challenges, such as climate change, ozone depletion, and exposure to hazardous substances. The EPA uses a range of tools and programs, including research and development, regulation, partnerships, and education and outreach, to achieve its mission. The agency also provides information and technical assistance to help individuals, communities, and businesses protect the environment and public health.

Learn more about EPA, here:

https://brainly.com/question/30240841

#SPJ1

Answer:

B . With monitoring, the concentration of every pollutant has decreased

Explanation:

What change caused the rate of population growth to increase around point C?

Answers

Answer:

point c

Explanation:

What are 2 facts about energy?

Answers

Answer: Only 10 percent of energy in a light bulb is used to create light. ...

The amount of energy Americans use doubles every 20 years. ...

Explanation:

Fact 1: Refrigerators in the U.S. consume about the same energy as 25 large power plants produce each year.

Fact 2: From 2008 to 2030, world energy consumption is expected to increase more than 55%.

What is the difference between your biological sex and your gender identity?

Answers

Answer:

Biological or assigned sex is about biology, anatomy, and chromosomes and Gender is society's set of expectations, standards, and characteristics about how men and women are supposed to act.

Explanation:

Hope this helps!

biological sex is what gender you were born as and what's on your birth certificate. however, a persons gender identity is a persons own choice. it's what you classify yourself as and what you feel comfortable as, despite your biological sex. many people don't even identify as anything or they change their preference of pronouns. gender identity also comes with stereotypes given by the community and what they see fit for genders.

What is the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers?
A) Heterotrophs
B) Decomposers
C) Detritivores
D) Autotrophs​

Answers

Answer:

Heterotrophs

Explanation:

A heterotroph is an organism that eats other plants or animals for energy and nutrients.

The correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

What are heterotrophs?

Heterotrophs are organisms which cannot produce their own food but rather depend on other organisms for its food.

Heterotrophs consume other organisms such as plants and other animals for the production of energy.

Therefore, the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

Learn more about heterotrophs at: https://brainly.com/question/4933024

When you by strawberry is "TEXTURE " matters? and why is that?

Answers

Answer:

Yes, it does.

Explanation:

If the strawberry you buy is all soggy and way too soft, it is likely rotten, while the normal texture we are used to shows that it is edible.

Answer:

Frozen strawberries were characterized organoleptically by a moist, soft and limp appearance, and poor shape retention. They felt very soft, moist, limp and slightly slimy in the mouth. Interior fibers had a tough texture.

HELP ASAP WILL GIVE BRAINLISET Which of the following describes the Cell Theory?

Group of answer choices

(A)All

(B)All living things are composed of one or more cells.

©Cells are the basic unit of life

(D)Cells are produced from existing cells

Answers

Answer:

C. Cells are the basic units of life.

Explanation:

Answer: A.) All
Explanation: Wikipedia :/

What is the strengths and weaknesses of the various developments in science and technology​

Answers

Answer:

Strengths, Weaknesses, Opportunities and Challenges ... Some have “ centres for research and development” while others ...

A rusty nail is an example of an oxidation-reduction reaction.
A. True
B. False

Answers

Answer:true

Explanation:

put "Speciation" in a sentence

Answers

Answer:

It flies in the face of currently accepted views of speciation.

Answer:

chromium speciation by different methods of practical use for routine in situ measurement.

Explanation:

A student tries to push a refrigerator-sized box of textbooks safely across the classroom.

The box does not move. He asks for help from other students.

The box starts to move when the number of students shown in the image is pushing together.



Based on this information, what conclusion can be drawn?




The box has a mass greater than the combined mass of the first two students pushing.


The forces acting on the box became unbalanced when the third student started pushing.


The only force acting on the box is the push applied by the students.


When the third student started to push, the box’s mass decreased

Answers

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

The horizontal forces, friction and applied, were balanced until more force was applied than friction. Mass can't increase or decrease.

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

describe how acid precipitation affects ecosystems
will give brain crown thingy

Answers

Answer: Acid rain makes such waters more acidic, which results in more aluminum absorption from soil, which is carried into lakes and streams. Trees' leaves and needles are also harmed by acids... They are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife.

Explanation: YW <3

the carbon cycle review of terms

Answers

Answer:

A solid line would represent point on the graph that actually are included in the solution, while points that lie on dash lines aren't included in the solution.

The carbon cycle takes place in the environment, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

What is the carbon cycle?

The carbon cycle is important for the environment because carbon is present in the animal cell, in food, etc., and the carbon cycle is present in the given diagram. Here, the plant takes in the atmospheric carbon dioxide shown in the arrow 1, and the carbon dioxide is released by the animals and plants shown in the arrow 2.

Arrow 3 explains the rabbit taking the carbon from the food source, the plant releases oxygen and arrow 4 explains the carbon released by the decomposers from the animals and plants; and arrow 5 shows the carbon converted into fossil fuels. Arrows 6 and 7 both explain the release of carbon dioxide while plants use it for food synthesis.

Hence, the carbon cycle takes place in the atmosphere, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

Learn more about the carbon cycle here.

https://brainly.com/question/1627609

#SPJ2

Which of the following most accurately describes the National Postsecondary Agricultural Student Organization?
(a)A rival group to FFA.
(b)2.A group similar to FFA but for graduate students.
(c)A group similar to FFA but for college students.
(d)The British version of FFA.

Answers

Answer:

Explanation:

a

Answer:

It's a

Explanation:

What type of material did the water most likely encounter when it stopped?

Answers

Answer:

Rocks

Explanation:

Rocks normally stop streams

Phineas and Ferb build a flying machine. They accelerate into the air in a
straight line, going from 0 m/s to 30 m/s in 3 s. Find their average
acceleration.

Answers

10

30 dived by 3 = 10

hope it helps

please help!! i’ll mark brainliest

Answers

Answer:

See if that helps, im pretty sure it increases :)

Explanation:

The rate of photosynthesis does not increase with higher temperatures for all plants. Plants which grow in colder climates have an optimum rate of photosynthesis at low temperatures. Therefore different types of plants have optimum temperatures for photosynthesis.

Which feature is forming?

Oceanic crust
Continental
crust
Lithosphere
Lithosphere
Asthenosphere

Answers

Answer:

An island

Explanation:

for me i got it right

Put "Evolution of Populations" in a sentence

Answers

Answer:

animals are examples of evolution of population

Explanation:

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

WILL GIVE BRAINLIEST!!

A magnetic globe is being held down on a base. When released, the globe rises above the base and eventually comes to rest floating above the base.

In which position shown does the globe have the greatest magnetic potential energy?

Answers

Answer:

Position 1 as the magnetic potential energy is waiting to be released when the hand moves.

Explanation:

Material rising from the mantle reaches the surface at spreading centers.
A. True
B. False

Answers

Yes, It's true!

Explanation:

Material rising from the mantle reaches the surface at spreading centers.

A. True

B. False

Which gland is known as the "master gland" because it sends chemical messages to many other glands?

Answers

Answer: pituitary gland

The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation

Answers

Answer:

I am pretty sure that the answer is C.

Hopes this helps.

Have a great day!!!!!!!

It is fermentation... bc it’s the total number

But this on your own sentences please

Answers

Since hydropower is powered by water, it’s a good fuel source. It will not contaminate the air like power plants that release fossil fuels, for example coal and oil. It does not rely on international fuel sources and lets each state make their own energy.

Which of the following has to
occur in order for mammals to
create offspring?
A. fertilization
B. self-reproduction
C. mutation
D. self-fertilization

Answers

A. Fertilization, would be your answer
Other Questions
A thin, horizontal, 14-cm-diameter copper plate is charged to 4.5 nC . Assume that the electrons are uniformly distributed on the surface.A. What is the strength of the electric field 0.1 mm above the center of the top surface of the plate?B. What is the strength of the electric field at the plate's center of mass?C. What is the strength of the electric field 0.1 mm below the center of the top surface of the plate? a plane approaches you at 760 mi/h. it produces a sound at a frequency of 256 hz. what frequency do you hear? let the speed of sound be 343 m/s, 1 mile = 1609.34 m, 1 hr = 3600 s In a patient who was in a motor vehicle crash, which sign most strongly suggests abdominal trauma?A. VomitingB. HypertensionC. TachycardiaD. Diarrhea Give the state diagram for a Turing machine that decides each of the following language over = {0, 1}: a) Lo= {w: w contains both the substrings 011 and 101} b) L7= {w: w contains at least two 0's and at most two ls} T/F: sanctions by the international community against burma (myanmar) have had the intended effect of reducing the drug trade in that country. assume that a town sells a truck that it had originally purchased for $55,000 for a cash sale price of $20,000. prepare the journal entry to record the sale. UV light is used in clean rooms and some operating rooms. What are the limitations of using UV light as a means of sterilization The difference between two natural numbers is 8. The product of these natural numbers is 345. Find these numbers. Can someone please provide a good explanation? compared to other industrialized nations, the united states ranks in the top five percent in voter participation. T/F A[n] _____ is any description of the good's physical nature or its use, either in general or specific circumstances, that becomes part of the contract.Acknowledged warrantyClaimed warrantyExpress warrantyImplied warrantyConsequential warranty Consider the tensor-valued function (A) = A2. Show that D(A)B = B A + A B, B V^2 18.8 The moment of inertia of the disk about O is I 20 kg-m. = Att = 0, the stationary disk is subjected to a constant 50 N-m torque.(a) What is the magnitude of the resulting angular acceleration of the disk?(b) How fast is the disk rotating (in rpm) at t = 4 s? True or false? Unconventional monetary policies include massive lending to banks and open-market purchases of assets other than Treasury bills. for the basic eoq model, what is the formula for the total annual cost? 2dh/s 2h/sd dq/s 2q/h (q/d)s (q/2)h (d/q)s (q/2)h 2ds/h after the liquid product is dried with sodium sulfate, it is transferred to a dry beaker, which itself weighs 28.50 g. the total weight now is 30.51 g. 8) Calculate the molality of an H2SO4 solution containing 50 g of H2SO4 in 450 g of H2O? M= mol 9) Calculate the percent composition by mass of the solute for a solution that contains 5.50 g of NaCl in 78.2 g of solution. True or false? Human relations theory is a theory that states that satisfying the needs of employers is key to productivity. General sensory information on its way to the cerebrum gets processed and relayed from which of the following areas of the brain?A) CerebellumB) MesencephalonC) ThalamusD) Pons (T/F) Time series data can exhibit seasonal patterns of less than one month in duration on the interval [a, b], the limit lim n[infinity] n f(xi)x i = 1 gives us the integral b f(x) dx a . for lim n[infinity] n xi ln(2 xi4) i = 1 x, we have f(x) =