Help me solve this problem
2|m/2|-1>3

Answers

Answer 1

Answer:

is this even a equation

Step-by-step explanation:


Related Questions

t/27 = 36 algebra, I'm stuck on this and can't figure it out

Answers

Answer:

972

Step-by-step explanation:

t/27=36

t=36*27

t=972

Answer:

t=972

Step-by-step explanation:

t = 27 x 36

t = 972

Check:

972/27 = 36

Check!

Hope that helps!

Two fuel tanks with the dimensions shown have the same volume. What is the value of ?

Answers

Answer:

The height is 2ft

Step-by-step explanation:

please help i dont know how to solve

Answers

Answer:

31°

Step-by-step explanation:

Angle KLN and Angle MLN equal 160° as said in the directions.

So 2y° + (3y + 5)° = 160° –– Combine like terms

5y + 5° = 160° ––Subtract 5 from both sides

5y° = 155° –– Divide both sides by 5 to get y alone

y = 31°

you read 165 pages in 3 hours find the unit rate

Answers

Answer:

55 pages per hour

Step-by-step explanation:

You divide 165 by 3 = 55

Please help! Will give Brainly!

Answers

Step-by-step explanation:

There are 5280 feet in a mile and 3600 seconds in an hour.

So a truck driving 45 miles an hour would be driving:

[tex]\frac{45 miles}{1 hour}[/tex] x [tex]\frac{1 hour}{3600 seconds}[/tex] x [tex]\frac{5280 feet}{1 mile}[/tex] = [tex]\frac{237600}{3600}[/tex] = 66 feet per seconds

Help will give crown Find the missing side length

Answers

Answer:

11cm

Step-by-step explanation:

Jim is using a grid to draw a scale
map of a park. Point F represents
the location of a drinking fountain
and Point
B represents the
location of a bench. Point F has the
coordinates (-6, 1) and Point B has
the coordinates (2, 4).
B
FI
Each unit on the grid represents 5
feet. About how far, in feet, is the
drinking fountain from
the bench?
A. 8.5 feet
B. 37.1 feet
C. 33.5 feet
D. 42.7 feet

Answers

Answer:

I'd say C

Step-by-step explanation:

p=

A. i
B. -1
C. -i
D. 1

Answers

Answer:

la respuesta es capó la B

Step-by-step explanation:

xeos para rellenar ti dirección para saber cómo está buenardo que la mujer de mi celular no puedo consultar con ningún compañero

17
How long will it take for $1,000 to increase to $3,000 if placed into an account earning 3.2% compound
quarterly? (round to the nearest year)
5

Answers

Sorry need points !!!!!

d) What would be the total cost of purchasing the number of shirts needed to use your coupon—after your coupon is applied and a 7.5% sales tax is charged on the purchase?

Answers

Answer: Multiply 7.5% by the price after subtracting the coupon's value.

Step-by-step explanation:

Let's assume that the cost of the shirts is x. So the coupon would subtract y from x so that's x-y which gives us z. Then to find z, on a calculator just put in 7.5% x z. I used variables since I don't know the value of the coupon or the original price of the shirts.

Clara earns $9 per hour for her work. She earned $315 last week

A. Write an equation to represent the number of hours (h) Clara worked last week. Write your answer in the text box

B. How many hours did Clara work last week?

Answers

Answer:

35 hours

Step-by-step explanation:

Clara worked for 35 hours because when you do $315/9 it equals 35. So 35 represents the hours she worked last week, and then the equation would just be, 315/9.

what is the least integer greater than -3.7

Answers

Answer:

-3

Step-by-step explanation:

An integer is a number that is a whole number (not a fraction). So, the least integer that is greater than -3.7, is -3.

I hope this helps!

Jeri asked 30 classmates how many liked chocolate cake,how many liked white cake,and how many liked neither.Eleven liked chocolate cake,and seven liked white.Assuming that all of her classmates replied,what percent liked neither?​

Answers

11/30 + 7/30 = 18/30

30/30 - 18/30 = 12/30

12/30 = 0.4

40% liked neither.

Answer:

percent of classmates looked liked neither of 'em=40%

Step-by-step explanation:

students who liked chocolate cake=11

students who liked white cake=7

students who didn't like either of it=30-18=12

percentage of ''=[tex]\frac{12}{30}[/tex] ×100=40%

Direction: Read and analyze each question below, the write the letter of the correct answer.

1. Which of the following is a conditional statement?
a. If Andrew cleans the room then Andrea cleans the kitchen.

b. Andrew and Andrea clean the kitchen.

c. None of the above

2. Which of the following is a converse statement of the sentence "If you eat vegetables, then you are healthy"?
a. If you are healthy, then you eat vegetables.

b. If you do not eat vegetables, then you are not healthy.

c. None of the above

3. Which of the following is the contrapositive statement of the sentence "If you eat vegetables, then you are healthy"?
a. If you are healthy, then you eat vegetables.

b. If you do not eat vegetables, then you are not healthy.

c. None of the above

NEED ASAP​

Answers

Answer:

1 is A

2 is A

3 is none of the above

Step-by-step explanation:

10 points possible. answer everything completely and I will mark brainliest

Answers

Answer: A is a function. B is not a function. C is a function. D is not a function. E is not a function. F is not a function. G is a function. H is a function. I is not a function.

Step-by-step explanation:

Find values of x and y for which ABCD must be a parallelogram. The diagram is not to
scale.

Answers

Step-by-step explanation:

again option D x = 10, y= 3

is the correct answer of this question.

plz mark my answer as brainlist.if you find it useful.

hope this will be helpful to you.

Answer:

x = 10

y = 7

Step-by-step explanation:

4x-2 = x+28

4x-x = 28+2

3x = 30

x = 30÷3

x = 10

4y-7 = y+14

4y-y = 14+7

3y = 21

y = 21÷3

y = 7

It usually takes Mary 6 hours to do the cleaning that Jane can do in 5 hours and Ellen can do in 4 hours. If
Jane and Ellen agree to help Mary so that they can all go on a picnic, how long will it take them to do the
cleaning?

Answers

Answer:

It will take them about 5 hours to do the cleaning.

Step-by-step explanation:

Since all three of them are going to do it together, you must find the average amount of time between the three of them. To do this you add all of their cleaning times, 6, 5 and 4, and them divide by the amount of people there. 6+5+4= 15, 15/3=5.

Help me plz someone??

Answers

Answer:

200π m²

Step-by-step explanation:

The lateral area (A) of a cone is calculated as

A = πrl ( r is the base radius and l the slant height )

Here r = 8 and l = 25, then

A = π × 8 × 25 = 200π cm²

aswdthjkl;hgfsdawdfhuh

Answers

Answer:

ong

Step-by-step explanation:

dude can you not spam???

What is the slope of the line that contains these points?
-1 1
3
5
y
10
2
-6
414

Answers

m=-1-1/10-2=-2/8= -1/4

Can any one help me out

Answers

Answer: A

Step-by-step explanation:

Answer: (-7,3)

Step-by-step explanation:

A

on a standard 6-sided die, what is the probability of rolling a 5?

Answers

Answer:

1/6

Step-by-step explanation:

PLEASE HELP ASAP!!
Graph the function
h (x) = -4x-1.

Answers

Answer:

Hope this helps!


Given the line y =2/3x-3
Write the equation of a line perpendicular to it that passes
through the point (4, -1)

Answers

Answer:

y= -3/2x + 5

Step-by-step explanation:

You do the opposite reciprocal of the original equation's slope.

Then you use the new slope from the point (4,-1) on the graph to find the y-intercept. Which is (0,5).

That gets your answer of -3/2x + 5.

Find the simple interest on 3,750 in 5 years at 3% rate per annum.

Answers

Answer:

562.5

Step-by-step explanation:

i=?

p=3750

r=3*1/100=3/100

t=5 years

I=P*R*T

3750*5*3/100

=5625/100

=562.5

5/7=12/y solve for y.

Answers

I believe the answer is 84/5

Answer:

Step-by-step explanation:

5/7 = 12/y

5y = 84

y = 84/5

help me please, lolllllllllllllllllll

Answers

Answer:

1728ft³

Step-by-step explanation:

Split the shape into the two rectangular prism that make it up

Volume of a rectangular prism=length*width*height

Small prism=10*12*3=360ft³

Big prism=19*12*6=1368ft³

Total=360ft³+1368ft³=1728ft³

I need help with this ASAP

Answers

18.84 !!!!!!!!!!!!!!!

Answer:

37.68

Step-by-step explanation:

Many insects migrate (travel) between their summer and winter homes. The desert locust migrates about 800 miles farther than the Monarch butterfly every spring, and the pink-spotted hawk moth migrates about 200 miles less than four times the distance of the Monarch butterfly every spring. Laid end to end, the distances traveled by a Monarch butterfly, a desert locust, and a pink-spotted hawk moth is about 12600 miles every spring. How far does each species travel?

Answers

Answer:

Distance travelled by Monarch butterfly = 2000 miles

Distance travelled by desert locust  = 2800

Distance travelled by pink-spotted hawk moth= 7800 miles

Step-by-step explanation:

Let the distance travelled by Monarch butterfly  be "X" miles

Distance travelled by desert locust is equal to X + 800 miles

Distance travelled by pink-spotted hawk moth is equal to 4X -200 miles

The total distance travelled by the three is equal to 12600 miles

[tex]X + X + 800 + 4X -200 = 12600\\6X = 12600 -600\\6X = 12000\\X = 2000[/tex]

Distance travelled by Monarch butterfly = 2000 miles

Distance travelled by desert locust  = 2000 + 800 = 2800

Distance travelled by pink-spotted hawk moth = 4 * 2000 -200 = 7800 miles

The table shows how many hours Sara spent at several activities one Saturday.
Activity "Hours
Soccer practice 2
Birthday party 3
Science project 1
What is the ratio of hours spent at soccer practice to hours spent at a birthday party?
Choose 1 answer:
1 for every 2
B
2 for every 1
2 for every 3
3 for every 2

Answers

Answer:

Its2 for every 3

Step-by-step explanation:

Other Questions
When does climate change occur? O When incoming radiation and outgoing radiation are in balance. When incoming radiation and outgoing radiation are not in balance. O When there is consistently no incoming radiation. O When there is consistently no outgoing radiation. A population of porcupines has the following genotypes in its gene pool; AA = 18. Aa = 26, aa = 20 What is the frequency of the dominant allele (p) in the population? (Give your answer to 3 decimal places) How can we shift our individualistic society to a collective one where we see ourselves as part of a larger community of humans who are connected to the natural world The generation that often tries to give up and assimilate its food patterns into the United States is the: Second generation. The predominant religion in ... Wich event occurred First in Martn luther long jrs life if accused of dismissing a potential juror because of race, what must a prosecutor do in order for the dismissal to be allowed? using the taylor remainder theorem, find all values of x for which this approximation is within 0.00447 of f ( x ) . assume for simplicity that we limit ourselves to | x | 2 . an indoor track is to be designed such that each end is a banked semi-circle with a radius of 24 m. what should the banking angle be for a person running at speed v = 6.0 m/s? What was the subtext when Tom told George that he would sell him the car?No plagiarism.Correct answers only 3cacl2(aq) 2na3po4(aq)6nacl(aq) ca3(po4)2(s) how many liters of 0.20m cacl2 will completely precipitate the ca2 in 0.50lof0.20mna3po4 solution? FILL IN THE BLANK. A system that supplies a ____ and is derived from a transformer rated no more than 1000 volt amperes does not require a grounding electrode conductor If the age of the Earth is 4.6 billion years, what should be the ratio of Opb in a uranium-bearing rock as old as the Earth? 238U 206Pb 238U = 0.9997 x determine the degree of the maclaurin polynomial of 10 sin (x) necessary to guarantee the error in the estimate of 10 sin (0.13) is less than 0.001. to test whether a change in price will have any impact on sales, what would be the critical values? use 0.05. question content area bottom part 1 a. 2.7765 b. 3.4954 c. 3.1634 d. 2.5706 which of the following are true about a strengths-based approach to motivation? check all that apply. an engineer enables packet screening in order to prevent any malicious activity over hypertext transfer protocol (http) web based traffic. which technology should the engineer utilize? Write a 4 paragraph about the pro and cons of Pasadena?Answer ASAP PLS Consider the following DNA fragment from four different suspects in a crime: Suspect 1 - ACGTACGGTCCGACCTT Suspect 2 - ACCTACGGCGGCGGTCCGACCTT Suspect 3 - ACATACGGTCCGACCTT Suspect 4 - ACGTACGGCGGTCCGACCTT Select all of the true statement(s) about these suspects and their DNA. Check All That Apply This stretch of DNA contains one SNP. This stretch of DNA contains two SNPs. Suspect 2 has three copies of an SNP. Suspects 1 and 3 have the same number of copies of an STR. Suspect 2 has three copies of an STR. can i get help on this please i don't understand it so if someone can help i will give brainy Question 5. The graph represents the path of a rock thrown from the top of a cliff by a hiker:Determine what the key features of the curve represent in terms of the path of the rock. Some ways in which lack of energy supply affects societal development