Conclusion for an onion cell lab report (hypotonic)

Answers

Answer 1

The results of the onion cell lab indicate that when placed in a hypotonic solution, the onion cells undergo changes in their physical appearance and characteristics.

What is conclusion?

After reading the paper, the conclusion should help the reader understand why your research is important to them.

A conclusion is a synthesis of key points, not just a summary of your points or a re-statement of your research problem.

In conclusion, the onion cell lab results show that when onion cells are placed in a hypotonic solution, their physical appearance and characteristics change.

Through osmosis, the cells absorb water and become turgid, causing the cell membrane to push against the cell wall. This can cause the cell wall to stretch and eventually burst, releasing the contents of the cell.

Thus, this can be the conclusion for an onion cell lab report (hypotonic).

For more details regarding conclusion, visit:

https://brainly.com/question/78686

#SPJ1


Related Questions

complete the t-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. some answers will fit in both columns depending on the situation. predator-prey relationships ___competition ___toxins ___new habitat ___disasters ____ increased food source ____

Answers

Complete the t-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. some answers will fit in both columns depending on the situation. predator-prey relationships decreases, competition decrease, toxins increase and decrease, new habitat decrease and increases, disasters decrease, increased food source increase.

Genetic variation are basically the alterations in the DNA sequences between the individuals who are a part of a population. Variation basically occurs in the germ cells, that is, sperm as well as the egg, and also occurs in somatic as well as all the other cells.

The number of different sources of genetic variation basically include mutation as well as genetic recombination. Mutations are considered as the ultimate sources of the genetic variation, but mechanisms, such as genetic drift also contribute. Due to it, there is a decrease in the predator-prey relationship as well as in competition and disasters which increases the food sources.

To know more about genetic variation here

https://brainly.com/question/848479

#SPJ4

If one of the interacting systems has illness, how will this affect the systems' performance?

Answers

Answer:

Explanation:

The human body is comprised of a series of complex systems, including the skeletal system, the respiratory and digestive systems, as well as the intricate networks of blood and lymph vessels, all controlled by the brain and nervous system.

what structure can the viral genome take? view available hint(s)for part a what structure can the viral genome take? ds-dna ss-dna ds-rna all of the listed responses are correct.

Answers

All of the listed responses are correct. (ds-DNA), (ss-RNA),and (ds-RNA).The genomes of all DNA viruses contain a single, double-stranded molecule which can be either linear or circular.

Chemical Composition and Method of Replication: A virus's genome is made up of DNA or RNA that can be single-stranded (ss), double-stranded (ds), linear, and circular. The whole genome may be contained within a single nucleic acid molecule (a monopartite genome) or several nucleic acid segments (multipartite genome). The genomes of all DNA viruses contain a single, double-stranded molecule which can be either linear or circular. The lone exception to this is parvoviruses. Circular DNA is a feature of both hepadnaviruses and papovaviruses. In a virus, a protein shell known as a capsid surrounds a single- or perhaps even double nucleic acid (DNA or RNA).

Learn more about genome

https://brainly.com/question/29482089

#SPJ4

Fill in the complimentary RNA sequence for the DNA sequence below if this sequence was being transcribed into messenger RNA: AAT CGA CTT ACC GCA TAT AGT ACT _______________________________________

Answers

The following RNA sequence would be complementary to the given DNA sequence:

UUA GCU GAA UGG CGU AUA UCA UGA

Using the base-pairing laws between DNA and RNA, we may get the corresponding RNA sequence for the provided DNA sequence.

Uracil pairs with adenine (A) (U)Guanine pairs with cytosine (C) (G)Cytosine (C) couples with guanine (G) (C)Adenine (A) couples with thymine (T) (A)

Keep in mind that U rather than T is used to create RNA during transcription, which is complementary to the template strand and occurs in the 5' to 3' orientation.

The RNA may be generated in accordance with the genetic information contained in the DNA thanks to the complementary pairing of bases between DNA and RNA. The base pairing regulations also have an impact on RNA folding and splicing, among other functions.

To know more about the base-pairing between DNA and RNA:

https://brainly.com/question/20949471

#SPJ4

Which of these big differences do you see between the sheep heart and the heart models in the lab manual?
A. the sheep heart has no chordae tendineae
B. the sheep heart does not have four chambers
C. the sheep heart does not have an apex
D. the sheep heart does not have an interventricular septum
E. all vessels on the sheep heart are the same color brown

Answers

The big difference between the sheep heart and the heart models in the lab manual is all vessels on the sheep heart are the same color brown.

Thus, the correct option is E.

What are the differences between a sheep heart and a human heart?

The sheep heаrt is more ventrаlly tilted аlong its long аxis thаn is the humаn heаrt аnd hаs а relаtively blunt аpex formed entirely by the left ventricle. Whereаs the normаl heаrt weight:body weight rаtio in аdult humаns hаs been reported to be 5 g/kg, the rаtio in sheep is 3 g/kg.

In the sheep heart models in the lab manual, all vessels on the sheep heart have the same color brown. It is because all vessels on the sheep's heart haven't a brown color. Only the left and right auricle has a brown color.

For more information about the sheep heаrt refers to the link: https://brainly.com/question/19425396

#SPJ4

during endocytosis volume decreases or increases​

Answers

Answer:

decreases

Explanation:

the rates of endocytosis and exocytosis rise as quick compressions occur, but the changes in cell volume and membrane tension are reduced.

Brendan made a chart to categorize the characteristics
of animals.
Characteristics of Animals
Always
Sometimes
Which phrase should be written in the column titled
"Sometimes"?
O Are multicellular
O Have membrane-bound organelles
O Produce their own food
O Display an asymmetrical body plan

Answers

"They are multicellular" phrase should be written in the column titled "Sometimes". Therefore, option A is correct.

What are the characteristics of animals?

Animals belong to the biological kingdom Animalia and are multicellular, eukaryotic creatures. Animals generally eat organic matter, breathe oxygen, can reproduce sexually, and form from a hollow ball of cells called a blastula during early development.

They are heterotrophic, they depend on producers for their food.

"They are multicellular" phrase should be written in the column titled "Sometimes". Therefore, option A is correct.

Learn more about animals, here:

https://brainly.com/question/9031447

#SPJ9

1. What types of cells contain chloroplasts?
2. What is the energy autotrophs use to make their own food?
3.The food making process is called: ____________
4.What are the raw materials for photosynthesis?
5.What simple sugar is produced?
6.What gas is used? ____________ What gas is released? ____________
7.Where are most photosynthetic cells in plants found?
8. About how many chloroplasts can be found in photosynthetic cells?
9. How many membranes surround a chloroplast?
10. The outer membrane is:____________
11. The individual sacs formed by the inner membrane are called ___________ and are arranged in __________ like pancakes.
12. What pigment is found inside a thylakoid? ____________ What color will it be in real cells?
13. Other pigments that trap sunlight are called a____________ pigments. What colors are these pigments?____________________________________
14. Stacks of thylakoids are called G____________(plural) or Granum (singular).
15. Stacks or grana are connected to each other by____________.

Answers

Answer:

1. plant cells

2. energy from the sun

3. Photosynthesis

4. water and carbon dioxide

5. glucose.

6. carbon dioxide

7.leaves

8. 100

9. 2

10. an integral component of the cell envelope of Gram-negative bacteria

11.  thylakoids,stacks

12.  Chlorophyll, green

13. yellow and orange

14. grana

15. lamellae

Explanation:

:)

T/F a drop of liquid that does not evaporate from brown paper after a 20-minute period at room temperature contains lipids.

Answers

Answer: True

Explanation:

A drop of liquid that does not evaporate from the brown paper after a 20-minute period at room temperature contains lipids. True. Lipids evaporate at a much slower rate than polar substances such as water. In addition, they will have a shiny or greasy appearance on brown paper.

which of the following statements about water is true? view available hint(s)for part a which of the following statements about water is true? water is not a good temperature buffer, because there is no hydrogen bonding between water molecules.

Answers

Option 3 is Correct. If the facts regarding water are correct, then water plays a significant part in the process of dehydration. Water becomes "hard" when calcium and magnesium salts, such as chloride, and sulfate, are present.

In the condensed phase, intermolecular hydrogen bonds rather than intramolecular hydrogen bonds exist in water. Wells and springs are sources of underground water. Rivers, lakes, ponds, oceans, and streams are examples of surface water sources.

Energy is not released by water. Every cell in the body benefits from it and remains healthy. Food and bodily waste are transported via it. Even when blazing hot, beryllium does not react with water; in fact, because it has a lower oxidation potential than the other components, its protective oxide film endures even at high temperatures.

Learn more about water Visit: brainly.com/question/24647400

#SPJ4

Correct Question:

Which of the following statements about water is true?

View Available Hint(s)

1. Water is an organic molecule.

2. Water is not a good temperature buffer, because there is no hydrogen bonding between water molecules.

3. Water plays an important role in dehydration synthesis.

4. Water is typically a nonpolar solvent.

Active transport is the process of
A. moving water through aquaporins.
B. moving substances down the concentration gradient.
C. assisting substances across the cell membrane with pores.
D. moving substances against the concentration gradient.

Answers

Active transport is the process of moving substances against the concentration gradient.

What are the four active modes of transportation?

A cell has four different types of transport mechanisms. There are four types of diffusion: simple diffusion, facilitated diffusion, primary active transport, and secondary active transport.

A protein pump uses energy in the form of ATP to move molecules from a low-concentration area to a high-concentration area during active transport.

Therefore, The sodium-potassium pump, which moves sodium ions to the outside of the cell and potassium ions to the inside, is an example of active transport.

Learn more about active transport from the given link.

https://brainly.com/question/29759743

#SPJ1

Characteristics of allergic purpura lesions include which of the following? (Select all that apply.)a. Fever and itching b. Easily palpatated lesions c. Bleeding from the lesionsd. Lesions located on the facee. Lesions located on the trunk

Answers

The characteristics of allergic purpura are fever and itching, easily palpated lesions. The correct option is Option A.

Henoch-Schoenlein purpura (also known as IgA vasculitis) is a common disorder that causes the small blood vessels under the skin, joints, intestines and kidneys to become inflamed and tend to bleed. Purpura lesions are generally itchy and fever can also occur due to these lesions. They are raised and are usually easily felt. Bleeding from the lesions themselves and generalized bleeding are uncommon. The lesions due to purpura tend to be found on the proximal extremities, especially on the legs and buttocks. The identifying feature of this form of vasculitis is the appearance of purplish rash, typically found on the lower legs and buttocks. It can also lead to abdominal pain and aching joints. Sometimes, chronic kidney damage can also occur.

For further learning about Purpura, refer to the link: https://brainly.com/question/26564682

#SPJ4

Energy storage molecule found in roots and seeds of plants Quickly accessed energy source Help protect vital organs Stored in fatty tissue; used for long-term energy storage Hydrophilic Insulation Hydrophobic Not a source of energy in organisms' diet Supplies organisms with energy if carbohydrates and fat are not available Wide range of functions: enzymes and signaling molecules Energy storage molecule found in muscles and the liver of animals Storage and processing of genetic information Carbohydrates Lipids Nucleic Acids Proteins

Answers

The three important sources of energy are carbohydrates, proteins, and fats. But nucleic acid helps in the transfer of genetic information.

Carbohydrates are considered the first source of energy for an organism. In animals, it is stored in the form of glycogen in muscle and liver. In plants, it is stored in the form of starch in its roots and seeds. They are hydrophilic because of the presence of OH groups and are quickly accessed for energy.

Lipids are hydrophobic molecules that play a major role in insulation from cold temperatures, act as long-term energy storage, protect vital organs, and are stored in fatty tissue called adipose tissue.

Nucleic acids are important for the transfer and processing of genetic information. They are hydrophilic because of phosphorus. Also, they do not act as an energy source.

Proteins can be both hydrophilic and hydrophobic based on their side chain. They also act as an energy source when fat and carbohydrates are unavailable. Some proteins are called enzymes and they also play a role in the signaling process. In plants, they are stored as an energy source in tubers, roots, and seeds.

To know more about carbohydrates:

https://brainly.com/question/29775112

#SPJ4

The complete question is -

Classify each of the following organic nutrients based on the descriptions provided. Answers may be used more than once.

Which is MOST difficult to collect from a decomposing body?

eggs
pupa
maggots
larva

Answers

Answer:

I would say it is Eggs or pupa.

Explanation:

Hope it helps, sorry I cannot give a clearer answer. Sorry if i am wrong.

Cody slips his little finger into the hand of his newborn infant, who immediately grasps onto it. The infant is exhibiting the ____ reflex.

Answers

Cody slips his little finger into the hand of his newborn infant, who immediately grasps onto it. The infant is exhibiting the _Palmar_ reflex.

What is Palmar reflex ?

When pressure and touch are provided to the newborn's palm, the palmar grip reflex enables them to clutch an object, although this action is not voluntary. Unfisting is the first clearly apparent fine motor skill necessary for appropriate growth.

One of the many infant reflexes that develops at birth is the palmar grip reflex, which enables your baby to close her fingers around an object put in her palm. Because of this, she will clench her fist and cling on hard when you put your finger or a little toy in her hand.

Learn more about Palmar reflex here:

https://brainly.com/question/3230071

#SPJ1

Describe protein folding. What causes an amino acid chain to fold?

Answers

Answer:

The process where proteins are folded into specific, three-dimensional shapes in order to function correctly, this is an essential cellular process. The endoplasmic reticulum is a cellular compartment where protein folding takes place.

Explanation:

What is its genotype?......​

Answers

Answer:

The genotype of a organism refers to the genetic makeup of that organism, which is determined by the combination of alleles (variations) in its DNA. In simpler terms, it is the particular set of genes that an organism has inherited from its parents. A genotype helps to determine an organism's phenotype (physical characteristics), which can be seen and observed.

complete the sentences to explain why the composition of the vapor is different from the composition of the solution.

Answers

The composition of the vapor is different from the composition of the solution because the vapor is the gaseous phase of a substance, while the solution is a homogeneous mixture of two or more substances

What is is a solution?

A solution is a homogeneous mixture of two or more substances in which the particles of the solute are evenly distributed throughout the solvent. The solute is the substance that is dissolved in the solvent, and the solvent is the substance that the solute is dissolved in. In a solution, the solute dissolves in the solvent to form a uniform mixture. The properties of the solution are often different from those of the individual components, and the concentration of the solute can vary depending on the amount of solute that is dissolved.

learn about vapor pressure here https://brainly.com/question/2693029

#SPJ1

put the following mechanisms for acid-base balance in order of their speed of action fastest to slowest.
1. respiratory system
2. Renal system
3. Chemical buffer system

Answers

In order of fastest to slowest, the chemical buffer system, respiratory system, and renal system.

When little amounts of an acid or a base are introduced, a chemical buffer system prevents the pH of the solution from changing. Weak acids and their salts or weak bases and their salts make up this substance, which aids in preserving a steady pH level in the body. In order to provide the body with oxygen and expel carbon dioxide, a network of organs and tissues is called the respiratory system. The diaphragm, bronchi, lungs, larynx, nose, mouth, and throat are all included in it. The urinary system, which is another name for the renal system, is in charge of filtering and getting rid of waste from the body. The urethra, bladder, ureters, and kidneys are all part of it.

To know more about renal system refer to the link below :

brainly.com/question/24232157

#SPJ4

Though dark and light phenotypes existed among the moth populations, an albino moth was recently discovered. Complete the data below in order to better understand how this may DNA = ATCG happen. Complementary rules MRNA-UAGS Dark moth - Dominant allele: DNA: TACCGTCGCATACACTGGGGTCAGGACGAGTCGCATCCAGACGGGTCGTCGGACATGATC mRNA: AAS: Light moth Recessive allele: DNA: mRNA: AAS: Albino moth DNA: mRNA: AAS: - TACCGTCGCATACACTGGGGTTAGGACGAGTCGCATCCAGACGGGTCGTCGGACATGATC Unknown allele: TACCGTCGCATACACTGGGGTCAGGACGAGATCGCATCCAGACGGGTCGTCGGACATGATC When responding below, be sure to use the precise terms for the mutations when appropriate. Write a claim to answer this question: What you think occurred to produce the dark and light phenotypes? Provide specific evidence from the mRNA-amino acid sequences for this claim: Propose a hypothesis as to what occurred to produce an albino moth:​

Answers

By 1900, the peppered moth populations in areas around English cities were as much as 98% dark moths. Scientists became curious why this was happening.

What are dark moths?

Eggs from light moths developed into light moths and dark moth eggs turned to dark adults. The dark color was caused by a mutation in the DNA of a single moth, and the mutated gene had been passed to all its offspring.

Why did dark moths have an advantage?

As the trees darkened with soot, the light-colored moths were easier to see. They were eaten by birds more and more, while the rare dark colored moths blended in better on the darker trees. This made the dark colored moths have a higher survival rate.

To know more about dark moths visit

https://brainly.com/question/14452844

#SPJ1

In which 2 organs is food broken down

Answers

The mouth and stomach break down food mechanically in the body.

What is Digestion?

Digestion is defined as the breakdown of large insoluble food molecules into smaller water soluble food molecules that they can absorb into the watery blood plasma. These small substances are absorbed into the bloodstream through the small intestine.

The food contains three macronutrients which require digestion before they can be absorbed such as fats, carbohydrates, and proteins. Mouth and stomach break down the food with the help of several enzymes.

Thus, the mouth and stomach break down food mechanically in the body.

Learn more about Digestion, here:

https://brainly.com/question/29028558

#SPJ9

Which of the following accurately describe how climate is affecting species across the planet? Select all that apply. Check All That Apply - Habitats are changing rapidly beyond those that a species can tolerate.- Habitats are being lost and are affecting species abunclance. - Habitats are changing rapidly, and these changes are affecting species behavior and their ability to adapt and survive in these new conditions.- As habitats change, species are moving to areas that they previously have never been recorded. - Habitat loss is only affecting a few relatively unknown species.

Answers

The statement that accurately describes how climate is affecting species across the planet is Habitats are changing rapidly, and these changes are affecting species' behavior and their ability to adapt and survive in these new conditions.

The c correct option is B.

What is climate change?

Long-term changes in temperature and weather patterns are referred to as climate change. These changes may be organic, but since the 1800s, human activity has been the primary cause of climate change. This is mainly because burning fossil fuels, such as coal, oil, and gas, release gases that trap heat.

The destruction of rainforests and the burning of fossil fuels are just two examples of human actions that have an increasing impact on the climate and temperature of the Earth. This increases the number of greenhouse gases already in the atmosphere, amplifying the greenhouse effect and contributing to global warming.

Learn more about climate change at: https://brainly.com/question/1789619

#SPJ1

which pair of locations listed below share the most similar longitude lines​

Answers

The pair of locations listed below that share the most similar longitude lines​ is Letters E and B.

The correct option is C.

What are longitude lines?

Meridians, which are also known as lines of longitude, are imaginary lines that split the globe. They quantify the distance either east or west, running from pole to pole from north to south. The prime meridian has a longitude of 0 degrees and passes through Greenwich, England.

The letters E and B are on the same longitude line.

Learn more about longitude lines at: https://brainly.com/question/17355844

#SPJ1

One of the major breakthroughs in understanding the mechanisms of evolutionary change came with the realization that evolution
A. takes place only within individuals.
B. was one minor way that populations change over time.
C. takes place at the level of populations, not within individuals.
D. was just a "theory" and therefore conjecture.

Answers

According to given information answer is takes place at the level of populations, not within individuals.

Which four main mechanisms underlie evolution?

The understanding that evolution A. exclusively occurs within individuals led to the development of evolutionary change mechanisms. B. was merely a modest example of how populations shift through time. C. occurs at the population level rather than the individual level. D. was merely a "theory" and so an assumption.

Violations of certain Hardy-Weinberg assumptions are consistent with evolutionary mechanisms. They are: natural selection, genetic drift, gene flow, limited population size, and mutation.

Which are the mechanisms underlying evolution?

A population, or a collection of interdependent animals of a specific organism, can display a variation of heterozygosity from one generations to the next through four main methods. These include natural selection, genetic drift, and mutation as forms of evolution.

To know more about  evolution visit:

https://brainly.com/question/13326304

#SPJ1

On a chromosome, a section of DNA sequence coding for information for a feature of an organism, such as flower color, is a(n)______, and different versions of this sequence, which impact a feature are called_______. explain your answer.
O allele; genes
O allele; characters
O gene; alleles
O gene; character
P chromatid; non sister chromatid

Answers

On a chromosome, a section of DNA sequence coding for information for a feature of an organism, such as flower color, is a gene, and different versions of this sequence, which impact a feature are called alleles.

A DNA sequence is a precise arrangement of the (deoxyribonucleotides) building blocks of DNA, which contain four distinct nucleotides: adenine (A), guanine (G), cytosine (C), and thymine (T). The sequence of nucleotides in a DNA sequence encodes genetic information that cells employ to generate certain proteins and execute various activities. The letters A, G, C, and T, which represent the nucleotides in the sequence, are commonly used to symbolise the DNA sequence. The genetic information stored in the DNA sequence is determined by the exact arrangement of these letters.

A gene is a piece of DNA that codes for a certain attribute or feature of an organism, such as flower colour. Alleles are different forms of the same gene that might result in phenotypic differences. In the instance of flower colour, for example, various alleles might result in different colours such as red, blue, or white.

For more such questions on chromosome, click on:

https://brainly.com/question/11912112

#SPJ4

the heart is located in the body cavities. dorsal, ventral, and pericardial thoracic, ventral and pleural ventral and thoracic ventral, thoracic and pericardial

Answers

The heart is located in the ventral, thoracic, and pericardial cavities of the body.

The ventral cavity is located on the front side of the body and contains several smaller cavities, including the thoracic and abdominal cavities. The thoracic cavity is located in the upper part of the ventral cavity and is surrounded by the ribcage. It contains the heart, lungs, and other important organs. The pericardial cavity is a small space within the thoracic cavity that surrounds the heart and contains a fluid-filled sac called the pericardium. The pleural cavity is also located within the thoracic cavity and surrounds the lungs. Overall, the heart is located in a complex system of interconnected cavities that work together to support the functioning of the body's vital organs.

Learn more about organs :

https://brainly.com/question/12825206

#SPJ4

fill in the blank. baroreceptors necessary for the baroreceptor reflex are located at the___.question 6 options:a) juxtaglomerular apparatus of the kidneyb) aortic sinus and the carotid sinusc) left and right atriad) internal and external jugular veins

Answers

The correct option is B ; Aortic sinus and the carotid sinus , Baroreceptors are mechanoreceptors that are found in the carotid sinus and aortic arch. Their job is to detect pressure changes by reacting to variations in artery wall tension.

Baroreceptors are sensory nerve endings found in the carotid sinuses, the aortic arch, and the right carotid and subclavian arteries . Changes in arterial blood pressure are detected by nerve endings.

Baroreceptors are spray-type nerve endings found on the walls of blood arteries and the heart that are activated by changes in arterial pressure. They are especially plentiful in the wall of the internal carotid artery bifurcation (carotid sinus) and the aortic arch.

Learn more about Baroreceptors

https://brainly.com/question/29618046

#SPJ4

Full Question ;

fill in the blank; Baroreceptors necessary for the baroreceptor reflex are located at the___.

question  6 options:

a) juxtaglomerular apparatus of the kidney

b) aortic sinus and the carotid sinus

c) left and right atria

d) internal and external jugular veins

the introductory passage describes how vibrio cholerae bacteria can take up genes from their prey through horizontal gene transfer. based on the introductory passage and the material in the chapter, classify the following examples of gene transfer as horizontal gene transfer, vertical gene transfer, or neither. drag and drop choices into the bins they describe.

Answers

A virus-recognized attachment receptor has undergone mutation on the surface of the host cell.

What is a gene, plainly speaking?

The basic structural and operational unit of heredity is the gene. the DNA that constitutes genes. Sometimes, genes act as the building blocks for the production of proteins. In contrast, a significant portion of genes do not code for proteins.

A gene example is exactly what?

The genes you inherit determine a variety of traits, including your skin and hair hues. Emma's mother might have two genes—one for brown hair and one for red hair—and may have passed one of them on to her. If her father possesses two genes for red hair, she might have it.

To know more about Gene visit:

https://brainly.com/question/8832859

#SPJ4

Suppose we are going to set up a Punnett square that concentrates on the smooth/wrinkled nature of the peas produced in a pea plant ("S" for smooth, "s" for wrinkled) and color of the pea produced ("Y" for yellow and "y" for green). What are all possible allele combinations for the gametes produced by a plant that is heterozygous in both traits?

Answers

SY, Sy, sY, and sy. A single gene in pea plants regulates pea texture. Smooth (S) peas outnumber wrinkly (S) peas in dominance.

A plant that produces wrinkled peas is bred with a plant that produces smooth peas. 252 of the offspring are wrinkle-free and 247 are smooth. Round (R) and Wrinkled (W) are the two alleles that determine the form of the seeds (r). The round form is dominant, whereas the wrinkled shape is recessive. Now, the genotype must be recessive homozygous for the wrinkly phenotype to manifest. As a result, rr is the genotype for the wrinkled phenotype. Pair the stray with a cat that doesn't curl. If there are any progeny with the "curl" characteristic, it is probably dominant.

Learn more about recessive here:

https://brainly.com/question/18075358

#SPJ4

you are about to use a dissecting microscope. which of the following statements describes the best settings to begin with to find your specimen on the stage?

Answers

A dissecting microscope, with a maximum magnification of 100x, is used to examine larger specimens and three-dimensional objects.

This kind of microscope may be used to investigate structures that are difficult to mount onto flat slides or to study the exterior features of an object. The compound light microscope is used to view objects that cannot be seen with the eye, such as cells, or that require closer inspection, such as blood samples, whereas the dissecting microscope is more helpful when viewing objects with low magnification, such as organ tissues. A stereo or a dissecting lens makes use of the object's reflected light. It magnifies at low power, making it perfect for enhancing things that are opaque.

Learn more about microscope

https://brainly.com/question/6686502

#SPJ4

Other Questions
Hector grew up in New York City, where his entire family also lived. His parents always told their kids that they're "city people." As he got older, his friends and siblings all settled down in New York City and other major cities around the world. Hector, on the other hand, ended up living in a small town in Montana where he can pursue his passionshiking and white-water rafting. Hector exemplifies the fact thata. some children are born to the wrong families.b. scholars have discarded the theory of socialization in favor of an interest-based explanation.c. although socialization matters, biology (nature) has a stronger impact on our behavior.d. even if socialization is a powerful process, human beings still have agency to behave differently then expected. 1. What does Winston think happened to his mother and father? 1984 book ela bpls help me :)i will be ur frind if u do lol Two metal spheres are connected by a metal wire that has a switch in the middle. Initially the switch is open. Sphere 1, with the larger radius, is given a positive charge Sphere 2, with the smaller radius, is neutral. Then the switch is closed. Afterward, Sphere 1 has charge Qi, is at potential Vi, and the electric field strength at its surface s E1-The values for Sphere 2 are Q2. V2, and E2. a) Is Vi larger than, smaller than, or equal to V2? Explain b) Is Qi larger than, smaller than, or equal to Qa? Explain. c) Is Ei larger than, smaller than, or equal to E2? Explain. If 5x+2=52, then what does x equal? How many oxygen formula units are in 85 grams are in (insert pic formula)? MM=601.9350 POINTS!!!!!!!! Given that the human body is mostly made of water, estimate the total amount of positive charge in a 70 kg person. Express your answer to two significant figures and include the appropriate units. "The present year witnesses the completion of the most important enterprise of the kind ever executed in any country a line of railroad from the Missouri River across the Continent, and with connecting lines from the Atlantic to Pacific Ocean. . . . the influence of these works . . . upon the commerce and welfare of this country must be immense. A vast commerce, yet in its infancy, already exists between the two shores of the Continent."-Source: Henry Varnum Poor, Manual of the Railroads of the United States, 1869-1870, 1889Which of the following most directly contributed to the developments described in the excerpt?answer choicestrade agreements and partnerships with European and Asian countriesgovernment loans to support railroad construction in the Westfederal legislation that gave land to families willing to work western landUnited States victory over the Confederate states in the Civil War Is Peter Brand from Moneyball real? which of these existential quantifications are true, where the domain of x is the positive integers? what are the harmful and beneficial effects of caffeine? 5. If a women starts ovulating at 13 and stops at 50 a) How many ova are likely to be released from her ovaries b) About how many of these are likely to be fertilized A flask filled with carbon dioxide is heated from 10. C to 40. C. The starting pressure was 98 kPa, what is the final pressure? What is the ending of Helter Skelter movie? Which of the following statements about functional strategy is BEST?A) Functional strategies are not impacted by the mission statement; instead they are impacted by the overall business strategy.B) Functional strategies determine the overall business strategy.C) Many functional-level strategies could readily be described as cross-functional.D) A firm's operations and supply chain strategy is more important than their marketing, finance and engineering strategies which of the following would be considered to be an operating expense for a computer manufacturing firm? question 28 options: accountant's wages assembly line wages disk drives memory chips speakers\ The dominance pattern of a gene can be determined from the phenotypes of the parents and offspring. In the examples below, assume that each parent is homozygous for the specific allele and that the progeny are heterozygous. Classify each example as either complete dominance, incomplete dominance, or codominance. Classily each example as either complete dominance, incomplete dominance, or codominance. Complete dominance Incomplete dominance Codominance A mother with type A blood and a father with type B blood have a daughter with type AB blood. A mother with straight hair and a father with curly hair have a son with wavy hair A green fish and a yellow fish have mottled green and yellow offspring. A black sheep and a white sheep produce a gray lamb. A pea plant with all purple flowers and a pea plant with all white flowers produce a pea plant with all purple flowers select all that apply standard deviations can be compared multiple select question. for data sets with different measurement units. for data sets with the same measurement units but greatly different magnitudes. only for data sets with the same measurement units and similar magnitude. only for data sets with the same measurement units. How do I enable console commands in HOI4? The conservation club coordinator is recruiting volunteers to help build a shed for recycling. She knows that finishing the shed will take 120 work hours. She figures out that if she can find one more person to help, the project will take a half hour less per volunteer. How many volunteers have already signed up?