Activity 3: Findings
3.1 Discuss THREE contributing factors that led to Gender Based Violence

Answers

Answer 1

THREE contributing factors that led to Gender Based Violence

Harmful gender norms. Gender stereotypes and are usually used to justify violence against womenHunger. Just as empowering women can help destroy hunger, food scarcity also leads to improved gender-based violence. War and conflict.

The major three contributing factors that led to gender-based violence are- harmful gender norms, hunger, war & conflict.

What are the reasons of gender-based violence explain them?

The unequal status of men and women is the primary cause of gender-based brutality. This inequality includes ideas that women should be economically dependent on men, and that females and children are a man's custody and under his control.

To learn more about Gender Based Violence, refer

https://brainly.com/question/16923564

#SPJ9


Related Questions

Provide three reasons why the assessment should be moderated by the subject departmental head.

Answers

There are many reasons why assessment should be moderated by the subject departmental head is as follows:

Because there is need of oversight, so the mistakes can be found if left uncovered

Who is Moderator?

A moderator is a person who reviews the subject, whether it be assessments, articles, blogs or any other matter.

Being a moderator is a job of responsibility as the review is done there are high chances that some errors or mistakes can be uncovered, these mistakes and errors may be effecting the whole subject and in some cases can be turn out be extremely negative.

The three reasons for review are as follows:

Because there is need of oversight, so the mistakes can be found if left uncovered

A fresh view can discover more errors and mistakes.

Subject departmental head would be expert in the subject and is fit to provide the review for the relevant subject.

Learn more about Assessments at https://brainly.com/question/27413813

#SPJ1

if a ping pong ball and a basketball were both dropped at the same time from the roof of our School which would hit the ground with a greater

Answers

Answer:

pingpong ball because small things take small area and give much more pressure on ground

20. Which of the following statements is ambiguous? A. Peter watched Hana throw a ball through the window. B. The water in this swimming pool is quite warm C. Mrs. Salsawit, my neighbor, is quite smart. D. Mr. Adam is really quite young. identify it​

Answers

Mr. Adam is really quite young - this statements is ambiguous.

What is ambiguous?

This word may mean "doubtful or uncertain especially from obscurity or indistinctness," "capable of being understood in two or more possible senses or ways," and "inexplicable." Although the words obscure and ambiguous have much in common, obscure implies a hiding or veiling of meaning through some inadequacy of expression or withholding of full knowledge. Ambivalent refers to having mixed, contradictory, or more than one feeling about something. Ambiguous, on the other hand, means unclear or able to be understood in multiple ways .

The correct answer is option D.

Learn more about ambiguous, refer:

https://brainly.com/question/2421724

#SPJ4

16-1. Which of the following would a Keynesian economist propose that the government do during a recession?
A.cut spending and run a deficit
B.spend money and increase taxes
C.cut spending and increase taxes
D.spend money and run a deficit

Answers

The option that would be proposed by a Keynesian economist to the government do during a recession is option C. cut spending and increase taxes. Read below about Keynesian economist.

Who is a Keynesian economist?

Keynesian economics were developed by British economist John Maynard Keynes during the 1930s in an attempt to understand the Great Depression. Keynesian economics are considered a demand-side theory that focuses on changes in the economy over the short run.

Therefore, the correct answer is option C. cut spending and increase taxes.

learn more about Keynesian economics: https://brainly.com/question/20036871

#SPJ1

State five basic principles of observation.

Answers

Answer:

observation, attention, retention, reproduction, and motivation

Explanation:

▼・ᴥ・▼

Observation, attention, recall, reproduction, and motivation are some of these concepts. A student should give the act of observing their complete and undivided attention. This makes sure that every aspect of the activities is accurately documented to allow for successful imitation.

Why observation is important?

The process of observation is crucial to science. Even if the experiment's outcomes are contrary to what we expected, it nevertheless allows us to perceive them. It enables us to observe unexpected items in our surroundings that could pique our curiosity and inspire fresh experimentation. Accurate observation is even more crucial than observation.

Theodore Bandura Bandura, who developed the idea of social learning theory, suggests five necessary phases for learning to occur: observation, attention, retention, reproduction, and motivation. The core of Bandura's social learning theory is observational learning. In addition, he underlined the importance of attention, retention, replication, and motivation as four prerequisites for any type of behavior observation and modeling.

Learn more about Principles of Observation here:

https://brainly.com/question/24666197

#SPJ5

In which tribe of Guinea, both men and women behave in ways in which we call “masculine”

Answers

Explanation:

Some of the most compelling evidence against a strong biological determination of gender roles comes from anthropologists, whose work on preindustrial societies demonstrates some striking gender variation from one culture to another. This variation underscores the impact of culture on how females and males think and behave.

Margaret Mead (1935) was one of the first anthropologists to study cultural differences in gender. In New Guinea she found three tribes—the Arapesh, the Mundugumor, and the Tchambuli—whose gender roles differed dramatically. In the Arapesh both sexes were gentle and nurturing. Both women and men spent much time with their children in a loving way and exhibited what we would normally call maternal behavior. In the Arapesh, then, different gender roles did not exist, and in fact, both sexes conformed to what Americans would normally call the female gender role.

eavy. 5. Archaeologists found evidence of ash at the site of Kurnool.​

Answers

A group of caves occupied by ancient humans has been discovered in Akkampalli near Kurnool district's Sanjamala.

The site, discovered by researcher K. Ramakrishna Reddy a occasional months ago, is thought to be contemporary to the current rock sites at Ketavaram and Chintakunta about Kadapa district's Muddanur.

What were located in Kurnool caves?

Fire. Traces of ashes have been seen in the Kurnool caves in Andhra Pradesh. This shows that the people who lived there learned the use of fire.

Fire might have been utilized for many things such as to cook meat, to get light, and to guard against animals.

What are Kurnool caves renowned for short answer?

The cave complex is among the largest and most extensive in the world and is known for its stalactite and stalagmite formations, intricate galleries, chambers, fresh water galleries, wells, waterfalls and siphons.

To learn more about caves, refer

https://brainly.com/question/7965722

#SPJ9

1. Even if we reach that state where an Al can behave as a human does, how do we measure if Al is acting like a human? and how can we be sure it can continue to behave that way? We can base the human-likeness of Al entity with the: Turingan Test, the Cognitive Modelling Approach, The Law of Thought Approach, and the Rational Agent Approach. Explain in detail these terms with suitable examples.​

Answers

Answer:

even if

Explanation:

It should be noted that the Turin test in AI is a method of inquiry that is used in artificial intelligence for determining whether or not a computer can be capable of thinking like a human being.

How to illustrate the information?

The cognitive modeling is an area of computer science which simply deals with the simulation of human problem-solving and mental processing that are in a computerized model.

It should be noted that such a model can be used to simulate human behavior or performance on tasks that are similar to the ones that are modeled.

The laws of thought are simply the fundamental axiomatic rules upon which the rational discourse can be based.

The rational agent approach is an agent that perceives and acts. The rational agent act rationally to reason logically and can then act on ones conclusions.

Learn more about AI on:

https://brainly.com/question/25523571

#SPJ1

Do you believe it is fair that the members of the United Nations Security Council have the most power in the United Nations considering Micronesia is not part of the UN Security Council?

Answers

It is fair that the United Nations Security Council has the most power in the U.N. even if Micronesia is not a member of the Council because membership rotates every two years.

Is it fair for the UNSC to have the most power in the U.N?

The UNSC is mandated to provide international peace and to do that, they need more powers. It is therefore fair for them to be as powerful as they are.

It is also fair because the members of this council are not all permanent and 10 of them are changed every 2 years to allow other nations to be a part of decisions regarding world peace.

Find out more on the United Nations Security Council at https://brainly.com/question/97111

#SPJ1

Why will you agree with the statement "The 1954 election is best remembered as setting the pace for regional and ethnic electoral politics in Ghana."​

Answers

The 1954 election is best remembered as the hallmark of regional and ethnic electoral politics in Ghana because the Ghanaian People's Party won.

What changes did the 1954 elections bring about in Ghana?

Through the victory of the Popular Party of the Kwame Nkrumah convention, there was the implementation of a new constitution with democratic ideals, which instituted political choice through the direct vote granted to all citizens.

Therefore, the 1954 elections led to the development of democracy in Ghana.

Find out more about Ghana here:

https://brainly.com/question/24673911

#SPJ1

Government imposed quantitative limits on the amount of pollution firms are allowed to produce is an example of.

Answers

Command-and-control approach to pollution reduction.

Government imposed quantitative limits on the amount of pollution firms are allowed to produce is an example of command-and-control approach to pollution reduction.

Explanation:

It requires firms to install environmental protection equipment as part of government policies that take into account the social costs of pollution. The US climate has been protected and cleaned up via the command-and-control rule.

I hope this helps :)

14. What characteristics, Qualities, or competencies do not make a successful Human Resource
Professional
A. Interpersonal competencies.
B. Business competencies.
C. Leadership competencies.

Answers

Answer:

interpersonal compleqtencie

Describe if you felt Jade's feedback was effective or not based on what you learned about feedback from the lecture.
List suggestions on how Jade could improve her feedback to Carla.

Answers

I feel it is very direct how Jade could improve her feedback to Carla.

Reading Jade’s feedback above, I feel it is very direct. I felt it was a bit too direct if I’m being honest. I like direct feedback, where there is no sugar coating and it gets straight to the point. I like to know exactly what is going on and if there is anything I can improve. But, not everyone does.

Jade’s email can be effective or be the complete opposite depending on how Carla takes the message.

Let’s just say she’s more of a personal communicator, I feel like Carla might be upset because of how to direct Jade is being. To help Jade and Carla come to an understanding with no defensive acts, using the four-step formula will help. Step One: The Micro-Yes, asking a question that is short but important

Hi Carla,

Do you have a few minutes to discuss the last report you sent me to proofread for you? I have a few things I’ve noticed that could greatly help both of us.

Step Two: Data Point, list specifically what you saw/heard. Be specific.

I’ve noticed in the last report that there are a lot of basic errors such as grammar and informalities.

Step Three: Show impact, name exactly how that data point impacted you.

It is taking me longer to proofread because of those basic errors in your report, I’m finding it very time-consuming.

Step Four: End on a question, wrap feedback message with a question. Is it possible for you to proofread before sending me the report? It will cut out a bunch of time and I will be able to give you quicker feedback on your report. What are your thoughts on that

Using the four-step formula will help Jade give her feedback to Carla without being too direct.

“Hi, Carla,

Do you have a few minutes to discuss the last report you sent me to proofread for you? I have a few things I’ve noticed that could greatly help both of us. I’ve noticed in the last report that there are a lot of basic errors such as grammar and informalities. It is taking me longer to proofread because of those basic errors in your report, I’m finding it very time-consuming. Is it possible for you to proofreading before sending me the report? It will cut out a bunch of time and I will be able to give you quicker feedback on your report. What are your thoughts on that?”

Learn more about feedback at

https://brainly.com/question/25653772

#SPJ1

6) List and explain the President's legislative powers. Be sure to include the following in your answer:

How does the President influence legislation? What is the State of the Union Address?

Answers

In accordance with the Constitution, the president has the power to grant pardons and reprieves, command the armed forces, request the written advice of the Cabinet, convene or adjourn Congress, and welcome diplomats.

The president is frequently referred to as the principal legislator because of his significant influence over the congressional agenda. Legislation passed by Congress can overcome a presidential veto if two-thirds of each house votes to do so. The president has the authority to veto legislation passed by Congress.

In yearly and unique statements to Congress, such as the annual State of the Union address and joint sessions of Congress, the president may personally suggest legislation. The president has the authority to call a special session of Congress if it adjourned without taking any action on recommendations.

The State of the Union Address is a yearly statement on the state of the country made by the president of the United States to a joint session of the United States Congress at the start of each calendar year.

To know more about the State of the Union Address refer to:   https://brainly.com/question/18132855

#SPJ1

Which action taken by a central bank would reflect expansionary monetary
policy?
• A. Raising reserve requirements for all banks
• B. Raising the interest that it pays to banks on the balance of their
reserves
XO C. Selling treasury securities to banks to reduce the money supply
V D. Lowering the discount rate to provide more loans to banks





D. Lowering the discount rate to provide more loans to banks

Answers

Answer:

Decreasing the discount rate.

Purchasing government securities.

Reducing the reserve requirement.

All of these options have the same purpose; to expand the money supply for the country.

Explanation:

A central bank, such as the Federal Reserve in the U.S., will use expansionary monetary policy to strengthen an economy.

The three key actions by the Fed to expand the economy include a decreased discount rate, buying government securities, and a lowered reserve ratio.

Quantitative easing is another monetary policy tool used by central banks.

The Fed implemented an expansionary policy during the 2000s following the Great Recession, lowering interest rates and utilizing quantitative easing.

An expansionary monetary policy goes hand in hand with an expansionary fiscal policy, the latter of which is managed by the government.

What dose law do for us?​

Answers

Answer:

Keeps all of us safe from trouble.

Explanation:

Laws are important so they can set limits to what can be done, how much it can be done, and what cannot be done. This keeps us safe from killing, being killed, robbing, breaking road rules, using weapons, etc. Laws may limit when we can use self-defence. It's to keep us all safe!

Does the sociological study of religion undermine one’s religion faith, make one’s religion faith stronger, or have no necessary implications for one’s religion faith?

Answers

No, Does the sociological study of religion does not  undermine one’s religion faith, make one’s religion faith stronger, or have no necessary implications for one’s religion faith.

How can sociology affect a religion?

Using the  functionalist perspective of sociological theory, religion  can be seen as the integrative force that is living with us , this  is as a result of the  power to shape collective beliefs.

In this case, sociological study of religion does not  undermine one’s religion faith, make one’s religion faith stronger, or have no necessary implications for one’s religion faith.

Learn more about sociological study on:

https://brainly.com/question/2652852

#SPJ1

part 3

You are in the 0-3 year room as a Trainee educator along with 3 other educators, Ashley, Daniel and Lauren. Ashley is reading a story with a group of children and asks if you can make a bottle for Lucy as she is getting ready to have her morning sleep. While you are doing this Daniel is changing a nappy and Lauren is at the door talking with another educator about their weekend with her back to the room. A parent comes into the room to drop off their child who appears to be upset. You can see a child climbing up onto a shelf and another child is waking up from their morning sleep and begins to cry.

Who could you ask to assist you during this time?

i need different points of views for answers to question

Answers

Lauren, she is clearly not doing anything and so should be able to help you out.

All of the following are characteristics of oligopoly EXCEPT
A. there is mutual interdependence between the firms.
B. there are high barriers to entry.
C. About 4 firms usually have 50% or more of the market share.
D. it is not possible to make profit in the long or short run.

Answers

All of the following are characteristics of oligopoly EXCEPT it is not possible to make profit in the long or short run.

What is oligopoly?

This is a market structure, where a very few large sellers dominate the industry in which emerging business cannot compete due to high costs of setting up.

Oligopoly occurs when most products or services are provided by only a few large companies or business.

Learn more about oligopoly here: https://brainly.com/question/13635083

#SPJ1

When is the only time you should enter two-way left turn lanes placed in the middle of two-way roads?.

Answers

Answer:Some streets have a center lane marked as a two-way left-turn lane. Only enter this lane when preparing to slow down or stop before making a left turn from the main roadway.

Explanation:

Go to this link to find out more about Bolivia’s economy to answer the question.
Use the information and the graphs to write two sentences about how Bolivia’s labor force by occupation compares to its GDP by sector.
Why might the percentages differ?

Answers

The Bolivian percentage of workers in agriculture is larger than the percentage that agriculture contributes to GDP and this is likely because industry and service workers contribute more to GDP on average.

what can be said on bolivia's gdp?

bolivia has more people working in the agricultural sector than the contribution to GDP as a percentage of agriculture.

this is most likely because services and industrial production bring in more value and output to the GDP than the percentage of people working in those sectors.

find out more on Bolivia's GDP at https://brainly.com/question/14469301.

#SPJ1

Individuals who are obsessed with eating healthy and have rigid eating styles and exercise patterns that affect the quality of their life and relationships may be described as having:_______

Answers

Individuals who are obsessed with eating healthy and have rigid eating styles and exercise patterns that affect the quality of their life and relationships may be described as having orthorexia.

Quality is the totality of functions and traits of a service or product that bear on its ability to fulfill given desires. Quality, is a distinguishing characteristic, a degree or grade of excellence.

Quality is the non-inferiority or superiority of something · Quality is an attribute or a property ·

Quality refers to how excellent something is. In business, we use the term in lots of situations. Quality control, for an instance, tests that goods have no defects.

learn more about quality here

https://brainly.com/question/26491505

#SPJ1

according to the European union's fourth directive the threshold for the entities obliged to report suspicious transactions decreased to

Answers

According to the European union's Fourth Directive, the threshold for the entities obliged to report suspicious transactions decreased to EUR 10,000.

What is the EU's Fourth Directive?

The EU's Fourth Directive is an anti-money laundering directive aimed at:

Combating money launderingFinancing of terrorismPreventing financial market abuse.

The Fourth Directive requires financial traders to conduct customer due diligence for transactions of EUR 10,000 or more.

Formerly, in the Third Directive, the threshold was EUR 15,000 or more.

Thus, according to the European union's Fourth Directive, the threshold for the entities obliged to report suspicious transactions decreased to EUR 10,000.

Learn more about Anti-Money Laundering at https://brainly.com/question/2588568

#SPJ1

"The United States is on its way to the biggest political and constitutional crisis since the Civil War, and within the next three or four years there is a high risk of massive violence, the collapse of federal authority, and the division of the country into Republican and Democratic enclaves." As conservative political scientist Robert Kagan said recently in a lengthy editorial published in The Washington Post, the article sparked much debate. He believes that two major threats are taking shape. First, if the body permits, "Donald Trump will be the Republican candidate for the 2024 presidential election." Second, the former president "and his Republican allies are actively preparing to use all necessary means to secure his victory.""The United States is on its way to the biggest political and constitutional crisis since the Civil War, and within the next three or four years there is a high risk of massive violence, the collapse of federal authority, and the division of the country into Republican and Democratic enclaves." As conservative political scientist Robert Kagan said recently in a lengthy editorial published in The Washington Post, the article sparked much debate. He believes that two major threats are taking shape. First, if the body permits, "Donald Trump will be the Republican candidate for the 2024 presidential election." Second, the former president "and his Republican allies are actively preparing to use all necessary means to secure his victory."

Answers

Answer:

Too long didn't read.

what do you even need help with?

Extreme values in a data distribution that are much lower or higher than the other distribution scores are called ______.
Group of answer choices

ranges

deductions

variances

outliers

Answers

Extreme values in a data distribution that are much lower or higher than the other distribution scores are called outliers.

An outlier or intense cost is described as a records factor that deviates up to now from the other observations, that it becomes suspicious to be generated by means of a completely exceptional mechanism or absolutely with the aid of errors. identifying outliers is important because the extreme values can: boom error variance.

An outlier is a remark that lies a strange distance from different values in a random sample of a population. In a sense, this definition leaves it up to the analyst (or a consensus system) to decide what will be taken into consideration as atypical.

If a price is a sure wide variety of trendy deviations away from the implied, that information factor is identified as an outlier. the specified quantity of well-known deviations is known as the edge. The default cost is 3. This approach can fail to detect outliers due to the fact the outliers growth the same old deviation.

Learn more about outliers here: https://brainly.com/question/2749543

#SPJ4

what does it mean to state something in social studies?​

Answers

Answer:

it means you giving an example about something and write something small about it

Organizations like the HBA-DC help support and strengthen our communities, our profession, and our country. Like many Americans, I came to this country with very little and I am grateful to this country for the opportunities it has provided. Those opportunities are there for all of us. How does this excerpt refine a larger idea in the present
?

Answers

The excerpt refine a larger idea in the present because it shows how helpful is the Organizations such as  HBA-DC help the communities and provide them with live changing opportunities.

How did the text provide the idea in the excerpt?

The excerpt provide the all the benefits that was gotten from the HBA-DC  organization.

The passage, cite evidence from those that have benefited from the organization like the person that came to the country with nothing but was able to acquire more.

Learn more about excerpt at:

https://brainly.com/question/24864502

#SPJ1

A table that displays the number of times a particular value or category is observed in the data is referred to as ______.
Group of answer choices

a descriptive analysis

a frequency distribution

measures of central tendency

measures of dispersion

Answers

A table that displays the number of times a particular value or category is observed in the data is called a frequency distribution.

Frequency distribution tables are a extra meaningful way to organize your statistics. suppose you have got a list of IQ ratings for a skilled study room in a selected elementary college.

The frequency of the cost is the variety of instances it occurs inside the dataset. The frequency distribution is the frequency pattern of a variable. this is the wide variety of instances each possible value of a variable happens in the dataset.

Cumulative frequency distribution. Relative frequency distribution. Relative cumulative frequency distribution. To do this, divide the frequency through the total wide variety of outcomes and multiply by a hundred. In this situation, the frequency of the primary row is 1 and the full quantity of effects is 10. In this situation, the share might be 10 The closing column is the cumulative percent.

Learn more about frequency distribution here: https://brainly.com/question/1094036

#SPJ1

2. What are the goals of expansionary monetary policy and contractionary monetary policy?



3. What are the differences between demand-side policies and supply-side policies?



4. How do government deficits cause a “crowding out” of private investment?



5. What is an automatic stabilizer, and how might an automatic stabilizer slow an economic recovery?



6. Is monetary policy or fiscal policy the more effective short-term approach? Explain your answer.

Answers

The goals of expansionary and contractionary monetary policy are to control the amount of money in the economy to influence economic activities.

What is the purpose of contractionary monetary policy?

It is introduced by the central bank to reduce the amount of money in a country. The purpose is to reduce economic activity and control inflation.

Expansionary monetary policy does the opposite and increases money supply in the economy so that economic activity is boosted.

Find out more on expansionary monetary policy at https://brainly.com/question/18939014

#SPJ1

If the epidemic heats up, the governor of New York said he would not rule out the resumption of school masks
Due to the Ba of Omicron variant virus The rapid spread of the 5 subspecies has led to an increase in hospitalized and confirmed cases in New York State, but Huo Chu pointed out that the current infection confirmation rate in New York state is about 37 cases per 100000 people, which is still very low compared with 381 cases per 100000 people at the peak of the Omicron epidemic at the beginning of this year.

Answers

It is advice able for the governor of New York not rule out the resumption of school masks even though there is  37 cases per 100000 people.

Why is it important to make use of the  school masks even though there is  37 cases per 100000 people?

It is essential to take a measure to prevent the Omicron variant virus because a virus tends to replicate itself rapidly.

If the Governor should wait till the number of the affected reach  381 cases per 100000 people  before taken measures, it can go out of hands.

Learn more about Virus at:

https://brainly.com/question/15636718

#SPJ1

Other Questions
if your vehicle becomes disabled your best course of action is to When does climate change occur? O When incoming radiation and outgoing radiation are in balance. When incoming radiation and outgoing radiation are not in balance. O When there is consistently no incoming radiation. O When there is consistently no outgoing radiation. A population of porcupines has the following genotypes in its gene pool; AA = 18. Aa = 26, aa = 20 What is the frequency of the dominant allele (p) in the population? (Give your answer to 3 decimal places) How can we shift our individualistic society to a collective one where we see ourselves as part of a larger community of humans who are connected to the natural world The generation that often tries to give up and assimilate its food patterns into the United States is the: Second generation. The predominant religion in ... Wich event occurred First in Martn luther long jrs life if accused of dismissing a potential juror because of race, what must a prosecutor do in order for the dismissal to be allowed? using the taylor remainder theorem, find all values of x for which this approximation is within 0.00447 of f ( x ) . assume for simplicity that we limit ourselves to | x | 2 . an indoor track is to be designed such that each end is a banked semi-circle with a radius of 24 m. what should the banking angle be for a person running at speed v = 6.0 m/s? What was the subtext when Tom told George that he would sell him the car?No plagiarism.Correct answers only 3cacl2(aq) 2na3po4(aq)6nacl(aq) ca3(po4)2(s) how many liters of 0.20m cacl2 will completely precipitate the ca2 in 0.50lof0.20mna3po4 solution? FILL IN THE BLANK. A system that supplies a ____ and is derived from a transformer rated no more than 1000 volt amperes does not require a grounding electrode conductor If the age of the Earth is 4.6 billion years, what should be the ratio of Opb in a uranium-bearing rock as old as the Earth? 238U 206Pb 238U = 0.9997 x determine the degree of the maclaurin polynomial of 10 sin (x) necessary to guarantee the error in the estimate of 10 sin (0.13) is less than 0.001. to test whether a change in price will have any impact on sales, what would be the critical values? use 0.05. question content area bottom part 1 a. 2.7765 b. 3.4954 c. 3.1634 d. 2.5706 which of the following are true about a strengths-based approach to motivation? check all that apply. an engineer enables packet screening in order to prevent any malicious activity over hypertext transfer protocol (http) web based traffic. which technology should the engineer utilize? Write a 4 paragraph about the pro and cons of Pasadena?Answer ASAP PLS Consider the following DNA fragment from four different suspects in a crime: Suspect 1 - ACGTACGGTCCGACCTT Suspect 2 - ACCTACGGCGGCGGTCCGACCTT Suspect 3 - ACATACGGTCCGACCTT Suspect 4 - ACGTACGGCGGTCCGACCTT Select all of the true statement(s) about these suspects and their DNA. Check All That Apply This stretch of DNA contains one SNP. This stretch of DNA contains two SNPs. Suspect 2 has three copies of an SNP. Suspects 1 and 3 have the same number of copies of an STR. Suspect 2 has three copies of an STR. can i get help on this please i don't understand it so if someone can help i will give brainy Question 5. The graph represents the path of a rock thrown from the top of a cliff by a hiker:Determine what the key features of the curve represent in terms of the path of the rock.