А
B
Lynn you're going to jump for the ball.
Lynn, you're going to jump for the
ball.
Lynn, you're going to jump for the
ball.
D
Lynn, you're going to jump, for the
ball.

Answers

Answer 1

Answer:

what's the problem asking


Related Questions

2. DO I NEED TO BRING DRINKING WATER TO MY AQUATIC FITNESS CLASSES for people

Answers

Answer:

yes

Explanation:

It is nice and the right thing to do

Why is act 3 scene 1 so important in William Shakespeare’s Hamlet ?

Answers

Answer:

Hamlet suggests that beauty can transform honesty into a “bawd,” but honesty cannot make a sinful woman pure once more. “I did love you once,” Hamlet tells Ophelia, and she retorts that Hamlet only made her believe that he did.

Explanation:

Which best describes the different points of view of these two passages?
The first passage is written from a third-person point
A) of view, while the second passage is written in first-
person point of view.
The first passage is written from a first-person point
B) of view, while the second passage is written in third-
person point of view.
The first passage is written from a first-person point
C) of view, while the second passage is written in a
second-person point of view.
The first passage is written from a second-person
D) point of view, while the second passage is written
from a first-person point of view.

Answers

Answer:

A

Explanation:

Im not 100% sure

Answer:

The answer is A

Explanation:

Why is it important to be able to identify the author's methods of persuasion? How will this benefit you in life? Explain.

Answers

Answer:

It's important to be able to identify the author's methods of persuasion because then you will be aware of the types of persuasion tricks that are being used on you in day-to-day life. Also, you can use persuasion skills to your advantage by using them on other people.

Explanation:

What type of sentence is this: The teacher did not approve of the behavior from her students; she expected more. *

Simple
Complex
Compound

Answers

Answer:

Compound sentence.

Explanation:

A compound sentence is a sentence that contains two or more independent clauses. Independent clauses are those words that can stand on their own as a full sentence and needs no dependent or other words to complete. Also, compound sentences using coordinating conjunctions to join the two independent clauses.

In the given sentence, there are two independent clauses separated by a semicolon.

Now, semicolons are used in place of conjunctions if the two sentences are related or close to each other. This means that we can replace conjunctions such as "like" or "and" in the sentence.

Likewise, the given sentence used the semicolon to connect the two independent clauses, making it a compound sentence.

The sentence cannot be a simple sentence as a simple sentence has only one subject and a verb.

And it cannot be a complex sentence as complex sentences contain an independent and dependent clause. And we have no dependent clause in the given sentence.

Thus, the correct answer is a compound sentence.

PLEASE HELP

Write a brief dialogue that reflects how women generally prefer to communicate.

Answers

Answer: sound

Explanation:

Answer:

As a female I would say I like to talk I don't know about other females but if I had a problem most likely I would like to talk and not beat around the bush if its like a problem that is easily solved. However if it's an argument that involves emotion it would have to depend on the problem.

Explanation:

What is the meaning of wicked? ​

Answers

Answer:

evil or morally wrong...............

Explanation:

1 . adjective

evil or morally wrong.

"a wicked and unscrupulous politician"

2 . intended to or capable of harming someone or something.

"he should be punished for his wicked driving"

3 . extremely unpleasant.

"despite the sun, the wind outside was wicked"

4 . playfully mischievous.

"Ben has a wicked sense of humor"

5 . excellent; wonderful.

"Sophie makes wicked cakes"

Read this sentence about Della from "The Gift of the Magi."

Once she faltered for a minute and stood still while a tear or two splashed on the worn red carpet.

What theme do Della’s actions in this sentence best suggest?

Answers

Read this sentence about Della from "The Gift of the Magi."

Once she faltered for a minute and stood still while a tear or two splashed on the worn red carpet.

What theme do Della's actions in this sentence best suggest?

Sacrifice is more important than true love.

Sacrifice for a loved one is not always easy.

Sacrifice is part of a life lived to the very fullest.

Sacrifice for a loved one does not always pay off

Answer:

Sacrifice for a loved one is not always easy.

Explanation:

plz help..
.
match words in A with a grammar term in B.​

Answers

Answer:

1. f         8. k      15. h

2. e       9. o

3. g       10. a

4. d       11. l

5. c       12. n

6. b       13. j

7. i         14. m

Explanation:

From the excerpt, I have been able to match words in A with a grammar term in B.

Adjectives are words that modify or qualify nouns or pronouns in a sentence.  Adverbs are words that modify verbs, clauses, adjectives, another adverb, etc., in a sentence.

Pronouns are words that are used instead of a noun. Nouns are names of places, people, animals or things e.g: car, tree, rice, etc. We have countable and uncountable nouns.

Verbs are words that show action or occurrence e.g: write, want. Prepositions are words or group of words that precede a noun or pronoun and shows relationship. e.g: on, at, under, etc.

10) In the excerpt below, select the transitional words and phrases.
First, do your research! While you might already have a destination in mind,
asking your friends and family for advice about places to go and things to do can
be very helpful. In addition to getting input from your family and friends, you
should utilize resources available on the internet, such as reviews written by
other travelers. Looking at photos of vacation spots can be a great way to get
ideas for choosing a destination, as well. It would also be helpful to begin
researching the anticipated costs of traveling, which leads to the next important
step-budgeting!
First
O O O
In addition
next
such as
for choosing
as well
which leads

Answers

Answer:

In addition, first , as well , which leads.

Explanation:

Why do you think Phillip Hoose titled this chapter “Crazy Times?”
Phillip Hoose titled this chapter “Crazy Times” because __________.

Answers

she was mad, crazy, and mental, they even made fun of her hair, she was going to have it straightened so she would look more white, I think that's right

pls answer quick plssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss

Answers

Lol what is this. I see no question, but thank you for the free points! Have a great day :)

Answer:

Where is the question?.

Which story premise most clearly contains a supernatural element?

Answers

Explanation:

(b) the haunted house at the amusement park is too scary for children under.12

We can see here that the story premise that most clearly contains a supernatural element is: B. The haunted house at the amusement park is too scary for children under 12.

What is story?

A story is a narrative or account of events, real or imagined, that are presented in a structured or sequential manner. It typically involves characters, a setting, a plot, and a theme.

Stories can be conveyed through various forms such as written literature, oral storytelling, films, plays, and more. They serve as a means of communication, entertainment, and imparting information or messages to an audience. Stories can be fictional or based on real-life events, and they often aim to engage the reader or listener emotionally and intellectually, taking them on a journey through the unfolding events and experiences of the characters.

Thus, we see that Option B is the the story premise that most clearly contains a supernatural element.

Learn more about story on https://brainly.com/question/25336781

#SPJ6

Determine the meaning of the italicized word in the following sentence based on the context clues provided
Mrs. Maple's dog obediently waited for his treat for fetching the
newspaper, despite his eagerness for it
(1 point)
A.happily
B.carefully
C.enthusiastically
D.willingly

Answers

C- enthusiastically

The meaning that the italicized words communicate effectively would be:

C). Enthusiastically

What are the context clues?

"Context clues" are characterized as the words that surround an unknown or unfamiliar word in a sentence.

These clues help the readers in determining the meaning of that word and make comprehension easier.

In the given sentence, the alien word "eagerness" conveys the meaning "enthusiastically" as the dog waited for his meal quite eagerly.

Learn more about "Words" here:

brainly.com/question/28611

What does irony add to the story "Lamb to the Slaughter?" i will give brainliest

Answers

Answer:

dahl uses dramatic irony when Mrs. Maloney asks the police to eat the murder weapon.  Roald Dahl uses dramatic irony(a case when the reader knows something the characters don't) in “Lamb to the Slaughter” to develop a feeling of suspense in the reader, leaving them wanting more.

Explanation:

are u asking why do they add it?

Sue Lewis was an accountant in 1943 and earned $12,000 that year. Her son is an accountant too and he earned $220,000 this year. Suppose the price index was 18.9 in 1943 and 20.5 in the current year. Sue's 1943 income in current year dollars is

Answers

Answer 15,000

Explanation:

Sue's 1943 income in the current year dollars is $13,016.

The price index reflects the average level of prices and can be used to compute the relative differences in the prices of the same basket of goods between some periods.

Data and Calculations:

Sue's 1943 income = $12,000

Son's income in the current year = $220,000

Price index in 1943 = 18.9

Price index in the current year = 20.5

Sue's 1943 income in current year dollars = $13,016 ($12,000 x 20.5/18.9)

Thus, Sue's earnings in 1943 is $13,016 in current year dollars.

Read more: https://brainly.com/question/23146120

Drag and drop the correct word into the correct location
It is important to organize the events in a narrative _________ , or in a way that makes sense to the reader .
A correctly
B logically
C alphabetically
D irrationally

Answers

Answer:

logically.

Logically means 'In a way that makes sense to the reader.'

Think carefully about the impact technology has on teenagers Lives. Write an essay explaining why new technology is so important to teenagers.
!!!!!HELLLLPPPP DO IN 10 MINS!!!!!!!​

Answers

Answer:

New technology has an impact on teenagers lives because social media is all society is about today and with teenagers that's all they care about. Talk about cyber bullying and the impact it has on society as a whole

you can’t write a good, solid essay in 10 minutes. but you could structure your essay about:
-the pressure teenagers feel to keep up to date with technological trends
-how technology will be a large aspect of the careers now-teenagers will go into
-how technology creates jobs (teenagers may have) for an ever-growing population
-how the modern world relies on technology more than it ever has before, and as teens grow into adulthood, technology will only advance
-technology helps connect teens around the world, especially at a time like this.
-new technology engineers new solutions for many emerging social issues such as sexism, racism, the hunger crisis, lack of education, and almost any other crisis you can think of.

The fireman were able to put _______ the fire in Church street.

Answers

I think the answer is (out )

How does the author convey the purpose in screen time can mess with the body's clock

Answers

Answer:

Scientists long have known that light at night can disrupt that internal clock. And it does so by suppressing melatonin. This prevents the body from getting the message that bedtime is near.

Explanation:

when is rain not welcome​

Answers

Explanation:

when is rain not welcome. i think when flood and Strom takes place.

when your at the beach, when your not wearing a sweater or when you don’t have an umbrella , sometimes when your at a funeral rain is not welcome because everyone is gonna be soaking wet

In front of, with regards to,so long as,dry bones.which of the following is a noun phrase

Answers

Answer:

Bone is a noun and a verb, but dry bones relates to a dead bowser or his minions. Mario?

Explanation:

my dog does not eatflesh​

Answers

Answer:

That's g r e a t??

ok ??? Kfkfkffkkdkd mmmmm

In the third paragraph, which of the following best describes the author’s perspective regarding orphan characters such as Harry Potter and Oliver Twist?

A. While orphan characters share many literary influences, they ultimately owe their distinctive identities to their respective creators.

B. Regardless of the different worlds inhabited by orphan characters, they are often equally popular with readers.

C. Despite the unusual challenges faced by many orphan characters, they typically overcome them.

D. Whereas many orphan characters have ideal qualities, modern readers no longer admire such perfection.

E. Although orphan characters share a marginal social status, they may not be equally complex.

Answers

Answer:

E

Explanation:

Just took it

.......... animal is her house.


a) shy

b) wild

c) safe

Answers

Answer:

wild

Explanation:

What is life? I need an answer!

Answers

Answer:

Explanation:

the condition that distinguishes animals and plants from inorganic matter, including the capacity for growth, reproduction, functional activity, and continual change preceding death.

You should know what life is by now, i thought everyone learned about it in 7th grade

This next paragraph will focus on high schools that require students to complete community service.


Strong: Claim

Weak: Not a Claim

Answers

Answer:

Not really sure but it could be Strong: Claim? I don't really know it does not make since.

Answer:

hi

Explanation:

How does Mrs. Keckley feel about Mrs. Lincoln. Book Behind the scenes

Answers

I know what the answer is i just don't know it at the moment so i'll be back in a minute with your answer

What Poetic Device is being used?

A. Repetition
B. Alliteration ( repetition of first consonant sound in string of words)
C. Extended Metaphor ( something is something else - an extended comparison of two unlike things)

Answers

Answer: Option C

Explanation:

Paul took the lunch money his dad gave him and used it to buy video games.
Is this a transgression against his father?

Answers

paul better get his money back or his mom is gon be mad
Other Questions
A slide at a children's park is 74 inches tall in the horizontal distance The slide covers is 70 inches what is the angle measures created by the slide and the ground a cyclist covers a distance of 15km in 2hours calculate his speed Who suspects Macbeth of foul play? 6.The bolded words are " I long to hear you", and " I long to hear you".Read the following passage from Shenandoah. Which sound device is expressed by the bolded words?Shenandoah, I long to hear you,Away, you rolling river,Oh, Shenandoah, I long to hear you,Away, I'm bound away,'Cross the wide Missouri.A. refrainB. repetitionC. alliterationD. rhyme Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located? Estoy tan aburrida as que aqu hay algunos puntos gratis. What percentage of Americans use solar power ?