Answer:
It is a eukaryotic cell
Explanation:
Eukaryotic cells have membrane-bound organelles (in this case the cell has a nuclear membrane with genetic information).
Bacteria, archaea, fungi, plants, and algae have a cell wall
PLS HELP IM TIMED!!
Fish eggs that are fertilized externally are typically clustered and covered in a thick, jelly-like substance.
What is most likely the function of this substance?
a) to protect the eggs and keep them consistently warm inside the parent's body
b) to protect the eggs and keep them safe from any harmful environmental conditions
c) to ensure that only a few of the eggs are fertilized by sperm since external fertilization is uncommon and risky
d) to ensure that only some of the eggs are fertilized by sperm so others can be fertilized internally
Answer:
Don't get me wrong but I think it's B
Explanation:
Answer:
The correct answer is B: to protect the eggs and keep them consistently warm inside the parent's body. It is correct on edge
Explanation:
Hope this helps and good luck:)
Astrology, look at the screenshot
Answer:
the day would get shorter.
hope it helps.
Answer:
year would get longer
Explanation:
primates evolved during what era
Project: Earths layers
Answer:
here hope helps
Explanation:
What does an ecopsychologist study? a. the mental health of environmental scientists b. the relationship between animals' interactions and their mental health c. the relationship between animals' behavior and the environment d. the relationship between a person's mental health and the environment
Answer:
The correct answer is d. the relationship between a person's mental health and the environment.
Explanation:
Ecopsychology is aimed at identifying the way in which the emotional aspects of human beings are influenced by the environment, that is, ecopsychology collects multiple experiences that connect human development with environmental awareness. Ecopsychologists are oriented to the search for the well-being of the human being through its connection with natural processes through the understanding of the complex interrelationships between people and the environment.
Answer:
The correct answer is d. the relationship between a person's mental health and the environment.
Explanation:
Ecopsychology is aimed at identifying the way in which the emotional aspects of human beings are influenced by the environment, that is, ecopsychology collects multiple experiences that connect human development with environmental awareness. Ecopsychologists are oriented to the search for the well-being of the human being through its connection with natural processes through the understanding of the complex interrelationships between people and the environment.
what are the advantages of anaerobic respiration and aerobic respiration?
My teacher is bugging me to answer this question help
NEED ANSWER ASAP
Students in a Biology class were formulating an argument about a cell they viewed under the microscope. Half
of the class argued it was a plant cell and the other half argued in favor of an animal cell. Below is the image the
students saw under the microscope. Which argument is supported by the image?
A. The students who said the plant cell are correct because there are chloroplasts
B. The students who said a plant cell are correct because there are mitochondria present.
C. The students who said animal cell are correct because there are chloroplasts present.
D. The students who said an animal cell are correct because there are mitochondria present.
Answer:
the answer would be A
Explanation:
Animal cells are oval and egg shaped so we can cancel out c and d
A is the correct answer because we can see green dots within the structure. Chloroplasts contain a green pigment called chlorophyll. This green pigment makes the chloroplast and the structure green (as we can see in the picture). Photosynthesis occurs in the chloroplasts, and it is where the plant gets its glucose from
Hope this helps!
Pls, I need help with this! Biology Thank you :)
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
I hit a substance with a hammer and it shatters.It is a
Answer:
non metal ,so it is brittle in nature
Procedure
1
2.
3
Place a strawberry in a zip-closure
bag and remove most of the air
before you seal the bag.
Add 2 tablespoons of the DNA
extracting solution
Mash the strawberry through
the bag in your hand. Do not hit
against the table as this might
damage the DNA
4
5
6
Continue mixing and mashing the
bag in your hand.
Place a piece of gauze over the
opening of the cup, securing it
with a rubber band.
Carefully pour the strawberry
mixture into the cup making sure
to catch the solids with the gauze.
7
8
9
27
Take a dropper or spoonful of the
liquid in the cup and place in the
test tube.
Add a dropper for spoonful of the
alcohol to the test tube. Take care
not to tilt or tip the test tube; do
not mix the two liquids.
Observe the line between the
strawberry mixture and the
alcohol.
Explain each step of the process,and the science behind why those steps needs to be completed. Please help I'll give you brainlest
why are viruses not regarded as true living cells?
Explanation:
Most biologists say no. Viruses are not made out of cells, they can't keep themselves in a stable state, they don't grow, and they can't make their own energy. Even though they definitely replicate and adapt to their environment, viruses are more like androids than real living organisms.
Viruses are not comprised of cells, they cannot maintain a stable internal environment, they cannot reproduce, and they cannot produce their own energy.
What is environment?Environment is defined as a compilation of all the factors living and nonliving and the outcomes they have on human life. Due to their ties to the forest, its plants, wildlife, water, and air. The air is filtered and hazardous gases are absorbed by the forest and trees. Plants filter water, lessen the likelihood of flooding, preserve the natural equilibrium, and do many other things.
Viruses are more like robots than actual living things, even though they do replicate and adapt to their surroundings. The viruses are thought to be dead in their natural habitat since they lack any cell-like properties. However, inside the host cell, the viruses employ the host's technological infrastructure to carry out all necessary tasks including reproduction.
Thus, viruses are not comprised of cells, they cannot maintain a stable internal environment, they cannot reproduce, and they cannot produce their own energy.
To learn more about environment, refer to the link below:
https://brainly.com/question/13107711
#SPJ6
How do you think about the invention of the microscope? Influenced the cell theory?
And what are the components of the cell theory?
Answer:
See the answer below
Explanation:
The invention of the microscope paved way for the development of the cell theory because, without it, the cell and all the organelles of the cell would not have been discovered and or studied in great detail. It was through the use of a microscope that Robert Hooke was able to observe and name the cell and it was through the same microscope that the fine details of the cell were able to be studied by other scientists, culminating in the formulation of the cell theory.
The cell theory states that all living organisms are made up of cells, the cell is the basic unit of all life, and cells can only arise from already existing cells (via cell division). The components of the cell theory, therefore, are:
Living organisms are made up of cells.The cell represents the basic unit of life.Cells can only arise from preexsiting cells.What is lapse rate with respect to the atmosphere?
Answer:
The term is almost always used with respect to temperature but is occasionally used for other variables.
Explanation:
Why would the atomic number be better to identify an element than the atomic mass?
Answer:
because the atomic number tells you how many protons and neutrons there are
Explanation:
2. What can you infer from the fact that ants make up
20 percent of the mass of all land animals combined?
a. Ants are very heavy
b. Ants live for a long time
c. Ants thrive in locations all over the world
d. Ants breed faster than any other organism on earth
Ant breed faster than any other organism on earth, 20% of earth mass have land animals. Many ants are on the earth. Thus, option D is correct.
What are the major features of ants ?Ants belongs to Formicide family which is related to so called eusocial insects like bees and termites. It is appeared in the Cretaceous period that is more than 90 million years ago.
The diversity of ants is every where except Antarctica.
The body has three parts such as a head, a meso-some and metasoma or gaster.
Ants are mostly omnivorous but can be scavengers , predators or herbivores based on ecological context.
The reproduction in which young, queens fly during mating time, fertilize with male, this flight is called as nuptial flight.
Then queen lay eggs, then larvae emerge to become pupae, then adults such as workers, soldiers, males or other queens are produced.
Thus, option D is correct.
Learn more about ants, here:
https://brainly.com/question/932986
#SPJ2
Explain the mechanism of ventilation in human lungs (you should talk about the diaphragm, abdominal muscles and rib cage and intercostal muscles)
Answer: When the diaphragm contracts, it moves inferiorly toward the abdominal cavity, creating a larger thoracic cavity and more space for the lungs. Contraction of the external intercostal muscles moves the ribs upward and outward, causing the rib cage to expand, which increases the volume of the thoracic cavity.
The movement of diaphragm and ribs govern the mechanism of ventilation in human lungs.
The ventilation in human lungs or pulmonary ventilation is defined as the process of intake of air during inhalation, and expiration as the release out of air. It is also termed as breathing.
What is the mechanism of pulmonary ventilation?The lungs are present in the thoracic cavity, with the diaphragm below the lungs separating the thoracic cavity from the abdominal cavity. The rib cage is present outside lungs and prevent them.
Inhalation process in pulmonary ventilationThe inhalation is the process of taking in air. The increase in the volume of lungs results in the increased movement of diaphragm to the abdominal cavity.
The intercostal muscles move upwards and the rib cage move outwards. Thus, the air is inhaled in the system.
Exhalation process in pulmonary ventilationThe exhalation of air is performed antagonist to the inhalation. The relaxation of diaphragm and the movement of rib cage results in the decreased volume of the lungs, and the air is expelled.
Thus, the movement of diaphragm and ribs govern the mechanism of ventilation in human lungs.
Learn more about pulmonary ventilation, here:
https://brainly.com/question/1933493
Which explanation describes why males are more likely to exhibit sex-linked disorders than females?
A male with a mutation in a gene on the X chromosome is typically affected with the condition. Because females have two copies of the X chromosome and males have only one X chromosome, X-linked recessive diseases are more common among males than females.
Help!! Please!! I'll name you brainliest!!
Explanation:
the same as the charge on the ion.+1 +2-25. -1
plz mark my answer as brainlist plzzzz you get it helpful ☺️.
Hope this will be helpful to you.
Which option identifies the most likely contributor to a microclimate that forms in a northern-facing valley?
exposure
shelter
precipitation
topography
Answer:
Topography
Explanation:
I just took the quiz.
Answer: pretty sure it’s topography
Explanation: edge 2021
Biology Grade 8
Match correct terms/meaning given in column 'B' with their correct levels
given in column 'A' with Column 'B'
Column A
a.Cell
b.Plant
c.Tissue
d.nose
e.organelle
column B
a.Group of similar cells
b.Heart
c.Ova
d.Organ
e.Group of different cells
f.Nucleus
g.organism
Answer:
cell=ova
plant=organism
tissue=group of similar cells
nose=organ
organelle=nucleus
What percent of the energy from an organism is passed to the organism that eats it?
10%
25%
100%
1%
10%
Explanation:
im sorry if im wrong but from what i learned thats the percentage
Answer:
10%
Explanation:
What cell structures are made in G1?
Answer:
Organelles
Explanation:
HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery
Answer:
A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.
Explanation:
Answer:
Mendel studied the genetics of pea plants.
Explanation:
Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.
Three things can happen at the boundaries between earths plates. If one plate moves underneath another it’s called a
Answer:
I believe it is called SUBDUCTION.
Earth's plates are called TECTONIC PLATES BTW
The roots allow for plants to bring in carbon dioxide and release oxygen.
True
False
Answer:
true 100 percent
Explanation:
please asap help i am not even sure if my ans is correct but help me out
Answer and Explanation:
Step 1:
Sound waves reach the bat's ears.
Step 2:
Sensory neurons send electrical signals to the brain.
Step 3:
Brain learns information about the environment.
Step 4:
Brain sends electrical signals to the muscles.
Step 5:
Bat flies away from the owl.
This is the correct way^
#teamtrees WAP (Water And Plant)
Water, ice, wind, sand, and chemicals are constantly crumbling mountains, flattening hills, widening valleys, and deepening canyons. __________________ never stops
Answer:
erosion
Explanation:
During G1, there is a great amount of protein _____________________ occurring.
Answer:
G1 is an intermediate phase occupying the time between the end of cell division in mitosis and the beginning of DNA replication during S phase. During this time, the cell grows in preparation for DNA replication, and certain intracellular components, such as the centrosomes undergo replication.
Explanation:
During G1, there is a great amount of protein synthesis occuring.
Please help me out!
Diploid is to Body Cell as Haploid is to?
-Sex Cells
-Zygote
-Chromosome
-Sex Chromosome