a kangaroo is a diploid animal that has 8 homologous pairs of chromosomes in a typical somatic cell. how many chromosomes would a kangaroo with the following chromosomal composition have?

Answers

Answer 1

A trisomic kangaroo would have 25 chromosomes, and a double monosomic kangaroo would have 15 chromosomes in a somatic cell.

A nullisomic kangaroo would have 7 chromosomes, a triple disomic kangaroo would have 23 chromosomes, and a tetraploid kangaroo would have 32 chromosomes.

a) In a trisomic somatic cell, one of the homologous pairs of chromosomes would have an extra copy, resulting in a total of 17 chromosomes (8 homologous pairs + 1 extra copy).

In a double monosomic somatic cell, two homologous pairs of chromosomes would be missing, resulting in a total of 12 chromosomes (8 homologous pairs - 2 missing pairs).

b) In a nullisomic somatic cell, one of the homologous pairs of chromosomes would be completely missing, resulting in a total of 14 chromosomes (8 homologous pairs - 1 missing pair).

In a triple disomic somatic cell, one of the homologous pairs of chromosomes would have two extra copies, while another pair would have one extra copy, resulting in a total of 19 chromosomes (8 homologous pairs + 3 extra copies).

In a tetraploid somatic cell, there would be four sets of 8 homologous pairs of chromosomes, resulting in a total of 32 chromosomes (8 homologous pairs x 4 sets).

Therefore, the correct answer for a) is 25, 23, and 24 chromosomes, respectively, and b) is 14, 26, and 32 chromosomes, respectively, depending on the scenario.

For more such answers on chromosomes

https://brainly.com/question/11912112

#SPJ11

Question

A kangaroo is a diploid animal that has 8 homologous pairs of chromosomes in a typical somatic cell. How many chromosomes would be in an

a. trisomic, double monosomic, somatic cell?

b. nullisomic, triple disomic, tetraploid cell?

Answer 2

The kangaroo would have 9 pairs of chromosomes or a total of 18 chromosomes.

Each homologous pair of chromosomes contains two chromosomes, so a diploid kangaroo with 8 homologous pairs of chromosomes would have a total of 16 chromosomes. However, the question does not provide information on how many additional chromosomes are present in this particular kangaroo, so we cannot determine the exact number of chromosomes. However, we do know that the kangaroo has an odd number of chromosomes, which means it has an extra chromosome in one of the pairs, resulting in a total of 9 pairs or 18 chromosomes.

Kangaroos, like all mammals, have two sets of chromosomes in their somatic cells, which means they are diploid organisms. Each set of chromosomes comes from one of the parents, and they contain the genetic information that determines the physical and biological characteristics of the kangaroo.

In a typical kangaroo somatic cell, there are 8 pairs of homologous chromosomes, which means that there are two copies of each chromosome. The chromosomes are said to be homologous because they carry the same genes in the same order, although the specific versions of those genes may differ.

However, it is important to note that the question does not provide information on how many additional chromosomes are present in this particular kangaroo. It only mentions the number of homologous pairs of chromosomes. Therefore, we can only infer that the kangaroo has an odd number of chromosomes, indicating that there is an extra chromosome in one of the pairs. This would result in a total of 9 pairs or 18 chromosomes in this particular kangaroo.

To know more about chromosomes

brainly.com/question/296477

#SPJ11


Related Questions

Put "Evolution of Populations" in a sentence

Answers

Answer:

animals are examples of evolution of population

Explanation:

Which of the following most accurately describes the National Postsecondary Agricultural Student Organization?
(a)A rival group to FFA.
(b)2.A group similar to FFA but for graduate students.
(c)A group similar to FFA but for college students.
(d)The British version of FFA.

Answers

Answer:

Explanation:

a

Answer:

It's a

Explanation:

A student tries to push a refrigerator-sized box of textbooks safely across the classroom.

The box does not move. He asks for help from other students.

The box starts to move when the number of students shown in the image is pushing together.



Based on this information, what conclusion can be drawn?




The box has a mass greater than the combined mass of the first two students pushing.


The forces acting on the box became unbalanced when the third student started pushing.


The only force acting on the box is the push applied by the students.


When the third student started to push, the box’s mass decreased

Answers

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

The horizontal forces, friction and applied, were balanced until more force was applied than friction. Mass can't increase or decrease.

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

The EPA sets national air-quality standards for common air pollutants. The
data table shows the change in concentrations of these pollutants over time.
Emissions Reductions and Air Quality
Data period
Reduction
Pollutant
Improvement
(from/to)
in emissions (%) in air quality (%)
СО
69
85
Pb
99
98
1980 - 2014 NO,
55
60
0,
53
33
81
80
16
30
2000 - 2014
33
36
SO2
PM,
PM25
Which conclusion do the data support?

Answers

The data support the conclusion that reducing emissions leads to improvement in air quality for the common air pollutants monitored by the EPA.

What is EPA?

The Environmental Protection Agency (EPA) is a federal agency of the United States government that was established in 1970 to protect human health and the environment. The EPA's mission is to ensure that all Americans have clean air to breathe, clean water to drink, and safe land to live and work on. The agency is responsible for setting and enforcing national standards for air and water quality, as well as for managing toxic waste and other pollutants.

The EPA also works with other federal agencies, states, tribes, and local governments to address environmental challenges, such as climate change, ozone depletion, and exposure to hazardous substances. The EPA uses a range of tools and programs, including research and development, regulation, partnerships, and education and outreach, to achieve its mission. The agency also provides information and technical assistance to help individuals, communities, and businesses protect the environment and public health.

Learn more about EPA, here:

https://brainly.com/question/30240841

#SPJ1

Answer:

B . With monitoring, the concentration of every pollutant has decreased

Explanation:

When you by strawberry is "TEXTURE " matters? and why is that?

Answers

Answer:

Yes, it does.

Explanation:

If the strawberry you buy is all soggy and way too soft, it is likely rotten, while the normal texture we are used to shows that it is edible.

Answer:

Frozen strawberries were characterized organoleptically by a moist, soft and limp appearance, and poor shape retention. They felt very soft, moist, limp and slightly slimy in the mouth. Interior fibers had a tough texture.

Phineas and Ferb build a flying machine. They accelerate into the air in a
straight line, going from 0 m/s to 30 m/s in 3 s. Find their average
acceleration.

Answers

10

30 dived by 3 = 10

hope it helps

The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation

Answers

Answer:

I am pretty sure that the answer is C.

Hopes this helps.

Have a great day!!!!!!!

It is fermentation... bc it’s the total number

Material rising from the mantle reaches the surface at spreading centers.
A. True
B. False

Answers

Yes, It's true!

Explanation:

Material rising from the mantle reaches the surface at spreading centers.

A. True

B. False

WILL GIVE BRAINLIEST!!

A magnetic globe is being held down on a base. When released, the globe rises above the base and eventually comes to rest floating above the base.

In which position shown does the globe have the greatest magnetic potential energy?

Answers

Answer:

Position 1 as the magnetic potential energy is waiting to be released when the hand moves.

Explanation:

the carbon cycle review of terms

Answers

Answer:

A solid line would represent point on the graph that actually are included in the solution, while points that lie on dash lines aren't included in the solution.

The carbon cycle takes place in the environment, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

What is the carbon cycle?

The carbon cycle is important for the environment because carbon is present in the animal cell, in food, etc., and the carbon cycle is present in the given diagram. Here, the plant takes in the atmospheric carbon dioxide shown in the arrow 1, and the carbon dioxide is released by the animals and plants shown in the arrow 2.

Arrow 3 explains the rabbit taking the carbon from the food source, the plant releases oxygen and arrow 4 explains the carbon released by the decomposers from the animals and plants; and arrow 5 shows the carbon converted into fossil fuels. Arrows 6 and 7 both explain the release of carbon dioxide while plants use it for food synthesis.

Hence, the carbon cycle takes place in the atmosphere, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

Learn more about the carbon cycle here.

https://brainly.com/question/1627609

#SPJ2

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

What is the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers?
A) Heterotrophs
B) Decomposers
C) Detritivores
D) Autotrophs​

Answers

Answer:

Heterotrophs

Explanation:

A heterotroph is an organism that eats other plants or animals for energy and nutrients.

The correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

What are heterotrophs?

Heterotrophs are organisms which cannot produce their own food but rather depend on other organisms for its food.

Heterotrophs consume other organisms such as plants and other animals for the production of energy.

Therefore, the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

Learn more about heterotrophs at: https://brainly.com/question/4933024

describe how acid precipitation affects ecosystems
will give brain crown thingy

Answers

Answer: Acid rain makes such waters more acidic, which results in more aluminum absorption from soil, which is carried into lakes and streams. Trees' leaves and needles are also harmed by acids... They are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife.

Explanation: YW <3

please help!! i’ll mark brainliest

Answers

Answer:

See if that helps, im pretty sure it increases :)

Explanation:

The rate of photosynthesis does not increase with higher temperatures for all plants. Plants which grow in colder climates have an optimum rate of photosynthesis at low temperatures. Therefore different types of plants have optimum temperatures for photosynthesis.

put "Speciation" in a sentence

Answers

Answer:

It flies in the face of currently accepted views of speciation.

Answer:

chromium speciation by different methods of practical use for routine in situ measurement.

Explanation:

Put "Allele Frequency" in a sentence

Answers

Answer:

With this data we can built a map of allele frequency and geographic location.

Answer: Here are a variety of sentences you could use...

1. Jensen was born with blue eyes because each of his parents gave him a recessive allele for the trait.

2. The dominant allele is the one that determines a physical characteristic or trait.  

3. Because Jill’s parents both gave her the dominant allele for curly hair, she has a wavy hair texture.

4. Which allele is responsible for blonde hair, the recessive allele or the dominant allele?  

5. On the other hand, the recessive allele is always overshadowed by its dominant partner.  

What are 2 facts about energy?

Answers

Answer: Only 10 percent of energy in a light bulb is used to create light. ...

The amount of energy Americans use doubles every 20 years. ...

Explanation:

Fact 1: Refrigerators in the U.S. consume about the same energy as 25 large power plants produce each year.

Fact 2: From 2008 to 2030, world energy consumption is expected to increase more than 55%.

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

Which of the following has to
occur in order for mammals to
create offspring?
A. fertilization
B. self-reproduction
C. mutation
D. self-fertilization

Answers

A. Fertilization, would be your answer

What is the difference between your biological sex and your gender identity?

Answers

Answer:

Biological or assigned sex is about biology, anatomy, and chromosomes and Gender is society's set of expectations, standards, and characteristics about how men and women are supposed to act.

Explanation:

Hope this helps!

biological sex is what gender you were born as and what's on your birth certificate. however, a persons gender identity is a persons own choice. it's what you classify yourself as and what you feel comfortable as, despite your biological sex. many people don't even identify as anything or they change their preference of pronouns. gender identity also comes with stereotypes given by the community and what they see fit for genders.

What type of material did the water most likely encounter when it stopped?

Answers

Answer:

Rocks

Explanation:

Rocks normally stop streams

Which feature is forming?

Oceanic crust
Continental
crust
Lithosphere
Lithosphere
Asthenosphere

Answers

Answer:

An island

Explanation:

for me i got it right

A rusty nail is an example of an oxidation-reduction reaction.
A. True
B. False

Answers

Answer:true

Explanation:

But this on your own sentences please

Answers

Since hydropower is powered by water, it’s a good fuel source. It will not contaminate the air like power plants that release fossil fuels, for example coal and oil. It does not rely on international fuel sources and lets each state make their own energy.

Which of the following statements is FALSE?
A. RNA is a single stranded molecule
B. RNA contains uracil
C. RNA is found only in the cytoplasm.
D. RNA contains ribose

Answers

Answer:

C

Explanation:

RNA is found mostly in the nucleus but can also be found in the cytoplasm, but it is not limited to it.

Which gland is known as the "master gland" because it sends chemical messages to many other glands?

Answers

Answer: pituitary gland

HELP ASAP WILL GIVE BRAINLISET Which of the following describes the Cell Theory?

Group of answer choices

(A)All

(B)All living things are composed of one or more cells.

©Cells are the basic unit of life

(D)Cells are produced from existing cells

Answers

Answer:

C. Cells are the basic units of life.

Explanation:

Answer: A.) All
Explanation: Wikipedia :/

With respect to normal base pairing, when a molecule of DNA replicates, thymine will most likely pair with 2 points

Answers

Answer: Adenine

Explanation:

The structure of the DNA double helix is complex in nature. There are two strands of DNA that are wound around each other. The nitrogenous bases are bonded with hydrogen bonding and base complementarity. According to the Chargaff's rule of base complementarity adenine always pairs with the thymine and guanine with cytosine. These nitrogenous bases are paired on the basis of hydrogen bonding. Adenine bonded with thymine through two hydrogen bonds whereas the cytosine pairs with guanine via three hydrogen bonds. During DNA denaturation these hydrogen bonds are broken whereas during DNA replication these hydrogen bonds are formed between the nitrogenous bases.

What is the strengths and weaknesses of the various developments in science and technology​

Answers

Answer:

Strengths, Weaknesses, Opportunities and Challenges ... Some have “ centres for research and development” while others ...

Which is an example of a ray-fin fish?
lungfish
O coelacanth
O shark
salmon

Answers

Explanation:

its showing all but salmon so im not sure,sorry, still trying

Answer: Salmon

Explanation:

bones

Other Questions
What scenario does the vocab word queda fit best?A. Laura asks a pedestrian how to get to a streetB. Laura gets lost on her way to a friends houseC.Laura tells her friend where her house is locatedD.laura turns left on her way to a friends house Roco draws two shapes. one of his shapes is 4 times longer and 4 times wider than the other. he found that the perimeter of the larger shape is 6 times larger than the perimeter of the smaller shapes and that the area is 16 times larger. is he correct? what did he calculate correctly: area, perimeter or both? f(x) = 2xg(x) = 8xFind (f g)(x). Assume x 0.OA. (f g)(x) = 4xOB. (f g)(x) = 8xO C. (f g)(x) = 4xOD. (f.g)(x) = /10x _____ is a technique to control for order effects without having all possible orders. The time lag for monetary policy is typically ________________ the time lag for fiscal policy. What are the domain and range of the function below? graphdomain: [0,00)range: (-00,00) domain [0,00) range: (-00,4] domain: (0,4) range:(-00,00) domain: (-00,4] range: [0,00) a gas has a density of 3.21 g/L at stp what is the gas Relationships and structures within a community that promote cooperation for mutual benefit describes:________ Describe how single-issue groups, ideological/social movements, and protest movements form with the goal of impacting society and policymaking. One of the first priorities of the Puritans upon arriving in North America was converting the Indians to Christianity. One of the first priorities of the Puritans upon arriving in North America was converting the Indians to Christianity. True False Which type of diet is discouraged because it is based on gimmicks that rarely lead to lasting weight loss or help retrain eating and exercise habits Axons of the spinal nerve that innervate the ventrolateral body surface, structures of the body wall, and limbs make up the The median for the samples from the 30 mile race of cars and SUVs are:The median of Sample 1 for cars is 132.The median of Sample 2 for SUVs is 115.What conclusions can you derive from the random samples?The sample size was too small to derive a valid conclusion.SUVs can perform well under testing conditions.Cars and SUVs performed equally well.Cars are slower than SUVs.Cars are faster than SUVs. Evaluate functions from their graph Problem g(3) =See attached for the correct answer!The notation g (3), left parenthesis, 3 refers to the output of the function when the input is x=. If the point (3, b) is on the graph, then g (3) =b.We should look for the point on the graph whose x- coordinate is 3 is the point )3, 4).The point on the graph whose x-coordinate is 3 is the point (3,4).Therefore, g (3) = 4 Which of the following procedures would allow you to make a spectrum of the Sun similar to the one shown, though with less detail If the party leadership in congress wanted to create party discipline, they would most likely use:_____. Suppose you are an engineer trying to recreate an experiment involving a weight on the end of a spring. This simulation will give you an idea of what the experiment will look like. For more information, you can visit this simple harmonic motion website. You are given the equation y(t)=2 sin 4 pi t + 5 cos 4pi t, which models the position of the weight, with respect to time. You need to find the amplitude of the oscillation, the angular frequency, and the initial conditions of the motion. You will also be required to find the time(s) at which the weight is at a particular position. To find this information, you need to convert the equation to the first form, y(t) = A sin (wt+0). Michael believes that when we are born, we are ready to learn about the world around us because we aren't born knowing anything at all. Michael's view seems to fit the idea of philosophical: A homeowner from State A hired a contractor from State B to build a vacation home for her in State C. The parties signe (Yield Problem)3Mg+2FeCl3=2Fe+3MgCl2When 20.5 g of Mg reacts with an excess of FeCl3, 25.9 g of Fe is produced. What is the percentyield of the reaction?