a jogger runs 8 miles north and then 5 miles west what is the shortest distance to the nearest tenth of a mile he must travel to return to his starting point​

Answers

Answer 1
C=9.4 Miles hope this helps

Related Questions

Two linear functions are shown.
Which function has the greater
initial value?
Function B
y = 6x + 3
Function A
Х y
- 1 9
0 6
1 3
2 0
Function has the greater initial value because the initial value for Function A is and the initial
value for Function B is
(Type integers or decimals.)
Enter your answer in the edit fields and then click Check Answer.
All parts showing

Answers

Answer:

Function A has a greater initial value because the initial value for Function A is 6 and the initial vale for Function B is 3

Step-by-step explanation:

The data for Function A is presented here as follows;

[tex]\begin{array}{cc}x&y\\-1&9\\0&6\\1&3\\2&0\end{array}[/tex]

The slope of the function, 'm', is given using any two points as follows;

m = (9 - 3)/((-1) - 1) = -3

The slope of the function = -3

The equation of function in point and slope form is given as follows;

y - 3 = -3·(x - 1)

The equation of Function A, is therefore, given as follows;

y = 3 - 3·x + 3 = 6 - 3·x

∴ y = 6 - 3·x

The equation of Function B is given as follows;

y = 6·x + 3

The initial value of a function is given by the y-intercept of the function, where the input variable (x-variable) is zero

The initial value, (y-intercept) of Function A, f(0) is therefore found as follows;

f(x) = y = 6 - 3·x

f(0) = 6 - 3×0 = 6

The initial value of Function A, f(0) = 6

Similarly, the initial value, (y-intercept) of Function B, f(0) is found as follows;

f(x) = y = 6·x + 3

f(0) = 6×0 + 3 = 3

The initial value of the Function B, f(0) = 3

Therefore, we have that Function A has a greater initial value than Function B


Pleaseee hurry and help

Answers

Answer: 37. 7in

12*3.14= 37.68

Rounded= 37.7 inches

Write the ratio as a fraction in simplest from 2ft to 30 in

Answers

Step-by-step explanation:

find the value of x in each triangle with the given angle measures ​

Answers

Answer:

10 - 104

11 - 25

12 - 64

13 - 109

14 - 33

15 - 90

Step-by-step explanation:

For the first 3 triangles u must add the two angles and minus it from 180

Q number 13 do the same thing then minus the number u got by 180

Q number 14 .... 66 - 180 = 33

Q number 15 it is a right angle so it is 90

How many terms? 7y-4+3f+6t

PLs I am doing a quiz

Answers

Answer:

B

Step-by-step explanation:

Answer:Only 1 term because the others are coefficients because they have a variable by them.

A study was conducted to investigate whether the mean price of a dozen eggs was different for two different grocery stores, Store A and Store B, in a large city. A carton of one dozen eggs from each store was randomly selected for each of 35 weeks, for a total sample size of 35 cartons from each store. The mean price of the 35 cartons was recorded for each store. The difference in the mean carton price for the stores will be calculated.

Which of the following is the appropriate test for the study?

A one-sample z -test for a population proportion

A one-sample t -test for a sample mean

A matched-pairs t -test for a mean difference

A two-sample t-test for a difference between population means

A two-sample z-test for a difference between population proportions

Answers

Answer:

A two-sample t-test for a difference between population means

Step-by-step explanation:

Answer:

D) A two-sample  t -test for a difference between population means

Step-by-step explanation:

Two random samples are selected on a quantitative variable, and the difference in the sample means will be calculated. The appropriate test is the two-sample t-test for a difference in population means.

add my sc tregan_fought

Answers

are you old???????????

Can you round 14.392

Answers

Answer:

The answer would be 14.0

Step-by-step explanation:

you would find what the decimal is and because it is below 14.49 you would round down

Please mark as brainllest i really need it have a nice week  

[o]-[o]

\___/

Da Baby has $45,000 and earns $2,500 each hour
from streams. JoJo Siwa has $62,000, earns $2,000
each hour from streams.
How
SI
Each equation represents the amount in the bank after
t hours.


Da Baby: s= 2,500t + 45,000
JoJo Siwa: s= = 2,000t + 62.000
How many hours, will it take for Da Baby and JoJo
Siwa to have the same amount in the bank?

Answers

Answer:

Step-by-step explanation:

maybe 30 vtfyubf6tyubtfcgnfgghghnvb ngvbhfhgbfvgn

Trigonometry help finding the value of x

Answers

Answer:

[tex]5\sqrt{3}[/tex] or 8.66

Step-by-step explanation:

use tan:

tan = [tex]\frac{opposite}{adjacent}[/tex]

⇒ tan 60 = [tex]\frac{x}{5}[/tex]

tan of 60 is 1.73

⇒ 1.732 = [tex]\frac{x}{5}[/tex]

multiply 5 on both sides

⇒ 1.732 x 5 = [tex]\frac{x}{5}[/tex] x 5

⇒ 8.66

Answer:

[tex]\boxed {\boxed {\sf D. \ 5 \sqrt 3 \ or \ 8.66}}[/tex]

Step-by-step explanation:

Remember the 3 main trigonometric ratios:

sinθ= opposite/hypotenuse cosθ= adjacent/hypotenuse tanθ= opposite/adjacent

We are given the 60 degree angle. 5 is adjacent to the angle and x is opposite. Therefore, we must tangent.

[tex]tan \theta= \frac {opposite}{adjacent}[/tex]

[tex]tan60=\frac {x}{5}[/tex]

Since we are solving for x, we must isolate that variable. It is being divided by 5 and the inverse of division is multiplication. Multiply both sides by 5.

[tex]5(tan60)=\frac {x}{5} *5[/tex]

[tex]5(tan60)=x\\5*$$1.73205080757= x\\8.66025403784=x[/tex]

If we round to the nearest hundredth, the 0 in the thousandth place tells us to leave the 6.

[tex]8.66 \approx x[/tex]

x is about 8.66 or 5√3, which is choice D.

24 is what percent of 60​

Answers

Answer: 14.4

Step-by-step explanation:

60 * (24/100) = 14.4

Which equation represents a line passing through the point (8, 9) with a slope of 3?

Answers

The equation of a line passing through the point (8, 9) with a slope of 3 is y = 3x - 15.

What is the equation of a line passing through two given points in 2-dimensional plane?

Suppose the given points are [tex](x_1, y_1) and (x_2, y_2),[/tex]

then the equation of the straight line joining both two points is given by

[tex](y - y_1) = \dfrac{y_2 - y_1}{x_2 - x_1} (x -x_1)[/tex]

We have been given a line passing through the point (8, 9) with a slope of 3.

then the equation of the straight line joining both two points is given by

[tex](y - y_1) = \dfrac{y_2 - y_1}{x_2 - x_1} (x -x_1)[/tex]

Its slope would be:

[tex]m = \dfrac{y_2-y_1}{x_2-x_1}[/tex]

m = 3

Therefore, the equation of the straight line

[tex](y - 9) = 3 (x -8)\\\\y - 9 = 3x - 24\\\\y = 3x -15[/tex]

Hence, the equation of a line passing through the point (8, 9) with a slope of 3 is y = 3x - 15.

Learn more about straight-line equations here:

https://brainly.com/question/380976

#SPJ2

Find the smallest number such that the remainder is 3 when it is divided by 16,20 or 24.​
(step required,thank you)

Answers

Answer: 123

Step-by-step explanation:

Foe us to solve this, we have to find the lowest common multiple of 16, 20 and 24 first and then add 3 to the LCM. This goes thus:

Multiples of 16 = 16, 32, 48, 64, 80, 96, 112, 128, 144, 160

Multiples of 20 = 20, 40, 60, 80, 10, 120, 140, 160

Multiples of 24 = 24, 48, 72, 96, 120

Therefore, the Lowe's common multiple is 120.

We then add the remainder of 3 and this will give:

= 120 + 3

= 123

a function may assign the same output value to two different input values

Answers

this is true i i i i i i i i i i i i

please help with explanation and show work :)

Answers

3. A=bh/2
2A=bh
h=2A/b.

8. Dy-Cx=E
Dy=E+Cx
y=(E+Cx)/D

please please complete it ​

Answers

Answer:

1. 14

2. 11

3. 19.5

4. 16

5. 76

6. 10

7.  2.5

8. 4.5

9. Mean: 10, Median: 9, Mode: 7

10. Mean: 6, Median: 7, Mode: 8,5

11. Mean: 10, Median: 11.5, Mode: 12

Step-by-step explanation:

if the temperature at the North Pole is -10º F, how many degrees would the temperature have to increase for it to be 0º?

Answers

Answer:

10 degrees

Step-by-step explanation:

:) Thank you enjoy your day kind human :)

Answer:

10.

Step-by-step explanation:

-10 + 10 = 0.

works the same for degrees as well.

what is the volume???

Answers

Answer:

that would be 80

Step-by-step explanation:

Here it is

Easy math question! Just need to subtract, help out ASAP!

Answers

Answer:

14,599

Step-by-step explanation:

Help!!!!!! Please I have no idea what this is!!!

Answers

Answer:

33.49 cubic units

Step-by-step explanation:

[tex]V_{sphere} = \frac{4}{3} \times \pi {r}^{3} \\ \\ V_{sphere} = \frac{4}{3} \times \pi {(2)}^{3} \\ \\ V_{sphere} = \frac{4}{3} \times \pi \times 8 \\ \\ V_{sphere} = \frac{32 \times 3.14}{3} \\ \\ V_{sphere} = \frac{100.48}{3} \\ \\ V_{sphere} = 33.4933333\\ \\ V_{sphere} \approx 33.49\: units^3 [/tex]

Put the following equation of a line into slope-intercept form, simplifying all fractions. x + 2y = 16​

Answers

Answer:

x + 2y = 16

The slope-intercept form is y=mx+b, where m is the slope and b is the y-intercept.

y=mx+b

Rewrite in slope-intercept form.

y= −1/2x+8

Step-by-step explanation:

Hope it is helpful...

Hey there!

The answer is y = [tex]\frac{-1}{2}[/tex]x + 8

To put it into slope-intercept form, we must get "y" by itself on one side of the equation. First, to do this, we will subtract "x" from both sides.

2y = -x + 16

Lastly, we divide both sides by 2

y = [tex]\frac{-1}{2}[/tex]x + 8

Have a super awesome day! :)

Help me plsssssssssssssssssssssssssss

Answers

Shshshsha wowowow okk 728

Answer: 37 cm^2

Step-by-step explanation:

Break the shape into two recognizable shapes. In this case a triangle and a square. To find area of a triangle use Area= 1/2 base x height. To find area of a square use Area = length x width. Then add the two together.

help pls ill mark best answer brainliest

Answers

Answer:d= 19

Step-by-step explanation:

I need help with it ​

Answers

Answer:

variable, variable, known, unknown

Step-by-step explanation:

please help me, i'll mark you brainiest
20 points

Answers

Answer: 4! 300:75     Hope you have a great day! Good luck on any stressful school homework stuff you have today too!

Step-by-step explanation: A fraction consists of two numbers and a fraction bar:

300/75

The number above the bar is the numerator: 300

The number below the bar is the denominator: 75

Divide the numerator by the denominator to get fraction's value:

300/75 =

300 ÷ 75 =

4:1

Jean junction is selling jeans at 12% off the regular price. The regular price is $32.00 per pair. What is the discount amount

Answers

Discount amount is 3.75 I think!

(2) Mai walked 1/8 of a 30-mile walking trail. How many miles did Mai walk? Explain or show your reasoning. *​

Answers

Answer: 3.75 miles

Step-by-step explanation:

Divide 30 by 8. 30/8= 3.75. If she walked 1/8 then she walked 3.75 miles

what is the area of circle if diameter is 6feet

Answers

Answer:

Area=πr²

=3.14×(6/2)²

=28.26 ft²

Step-by-step explanation:

In a new movie
theatre, seats will
be installed in the
unshaded area
How many square
feet are available
for seats?

Answers

Answer. 655.4

Step-by-step explanation:

what did u get?

A shipping and handling free 35.00 is charged to all furniture over $250 if the order is $437.50 what percent is the shipping and handling free?

Answers

Answer:

8%

Step-by-step explanation:

Divide 35 and 437.50 and you get 0.8

Then multiply .8 times 100 = 8%

the other person is correct give brainliest
Other Questions
what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located? Estoy tan aburrida as que aqu hay algunos puntos gratis. What percentage of Americans use solar power ? Copy the shape and fill in the missing angle. Sow the work. Thanks. hey can someone give me an idea how I should do a rough draft on a computer What is the range of the function y=-2/3x-10given a domain of{-9,-3,0,3,9} Read this sentence from paragraph 2 of "Puzzle Solved"Solving this thing is as easy asslaying Medusa!Why does Anya compare the cryptogram to slaying Medusa?A It is difficult to conquerOB. It is based on mythologyoc. It is not what it seems.OD. It is hard to look at. A 55 kg boy is riding a skateboard at a speed of 1.0 m/s. What is hiskinetic energy? A right rectangular prism has a length of 6 centimeters, a width of 7 centimeters, and a height of 5 centimeters. What is the volume of the prism? ____cm3a) 214b) 197c) 210CORRECT ANSWER= BRAINLY!! 60>x and x >57A x=61B x=59C x=50 In a transverse wave, the distance from any two consecutive crest or any two consecutive troughs is called the How will the motion of an object be affected if equal forces are applied in opposite directions? Pls, answer asap!When two objects of different temperatures are placed in contact with one another, eventually: (choose one option from below)a) both their average kinetic energy and temperature will be the sameb) their average kinetic energy will be the samec) neither their average kinetic energy and temperature will be the samed) their temperature will be the same 1 NEED HELP ASAP WILL GIVE BRAINLY