1.24) George rides his bike to his friend's house that is 5 kilometers from his house. If he rides
his bike at an average speed of 15 km/h, how long will it take him to get to his
friend's house?
t=d

Answers

Answer 1

Answer:

5 km / 15 km/h = 0.3333 hours

Step-by-step explanation:

This is calculated by dividing the distance he has to travel (5 km) by his average speed (15 km/h) and then converting the result to minutes.

0.3333 hours x 60 minutes/hour = 20 minutes


Related Questions

To graph the inequality y < 2x - 1, you would draw a solid line. A true B false

Answers

I think the answer is (A) True.

Hope it helps : )

True

Personally, when I see the line underneath the equality sign, I know I've got to draw a dotted line. That's how I remember the difference between drawing a solid / dotted line.

Hope this helps!

PLEASE NEED HELP
A machine at a food-distribution factory fills boxes of rice. The distribution of the weights of filled boxes of rice has an approximately Normal distribution, with a mean of 28.2 ounces and a standard deviation of 0.4 ounces. Boxes are often weighed before shipping, and any box with a weight of at most 27.5 ounces is considered underweight and is rejected for distribution. What percentage of filled boxes of rice are rejected for distribution?

Find the z-table here.

4.0%
24.2%
75.8%
96.0%

Answers

Answer:

D) 96%

Step-by-step explanation:

If you take 96% of 28.6 you get 27.6 so it fits

Craig decides to purchase a property that has been valued at $475,000. He has $80,000 available as a deposit and will require a mortgage for the remaining amount. The bank offers him a 25 year mortgage at 2% interest. Calculate the total interest he will pay over the life of the loan, assuming he makes monthly payments. Give your answer in dollars to the nearest ten dollars. Do not include commas or the dollar sign in your answer.

THE REAL ANSWER IS $107, 270


First, we note that Craig requires a mortgage on $475,000−$80,000=$395,000. To calculate the monthly repayments we must apply the formula for P0 and solve for d, that is,
P0=d(1−(1+rk)−Nk)(rk).
We have P0=$395,000,r=0.02,k=12,N=25, so substituting in the numbers into the formula gives
$395,000=d(1−(1+0.0212)−25⋅12)(0.0212),
that is,
$395,000=235.9301d⟹d=$1,674.22.
Therefore the total interest payable is
I=$1,674.22×25×12−$395,000=$107,266
which is $107,270 to the nearest $1

Answers

The total interest is $107,270

What is monthly payment formula?

The formula for monthly payment is:

[tex]M = \frac{P(\frac{r}{12})( 1+\frac{r}{12})}{( 1+\frac{r}{12})^n-1}[/tex]

We can find total interest as shown below:

Value of property = $475,000

Money available as a deposit = $80,000

P = 475,000-80,000

= 395000

t = 25 year

r = 2% = 0.02

n = 25*12 = 300

[tex]M = \frac{P(\frac{r}{12})( 1+\frac{r}{12})}{( 1+\frac{r}{12})^n-1}[/tex]

Putting the value of P, t, r, and n in the above formula

[tex]=\frac{395000(\frac{0.02}{12} )(1+\frac{0.02}{12}) }{(1+\frac{0.02}{12})^{300}-1}[/tex]

after solving the above expression

M = $1674.22

Interest = M*n-P

Putting the value of P, n and M

= 1674.22*300-395000

= 502266-395000

= 107,266

Rounding to nearest ten dollar

= $107,270

Hence, the total interest is $107,270.

Learn more about Mortgage here:

https://brainly.com/question/24188673

#SPJ1

Answer:

Step-by-step explanation:

Ivy is running errands for her mother. She bikes along straight paths to the supermarket, the bank, and then back home.Find the distance between Ivy's house and the supermarket and the distance between the supermarket and the bank. Each distance is rounded to the nearest meter.

Answers

The distance between Ivy's house and the supermarket and the distance between the supermarket and the bank:
H&S = 1,014 M; and S&B = 854m. This is resolved using the Sine Theorem.

What is the calculation backing the above solution?

Notice that the Angles of a Triangle add up to 180° That is

∠A + ∠B  + ∠C = 180°

Thus,

∠C = 180° - 32° - 109°

= 39°

Recall the Sine Theorem which indicates;

a/SinA = b/SinB = c/SinC

thus given that

AC = 1,523m

We have

AC/SinB = BC/SinA


BC = AC/SinB * SinA

= 1523/Sin109° * Sin32°

BC =854m

Therefore

AC/SinB = AB/SinC
Thus,

AB = AC/SinB * SinC

= 1523/Sin109° * Sin39°
AB ≈ 1,014m

Learn more about the Sine Theorem at;
https://brainly.com/question/27174058
#SPJ1

According to the Rational Root Theorem, which function has the same set of potential rational roots as the function g(x) = 3x5 – 2x4 + 9x3 – x2 + 12?
f(x) = 3x5 – 2x4 – 9x3 + x2 – 12
f(x) = 3x6 – 2x5 + 9x4 – x3 + 12x
f(x) = 12x5 – 2x4 + 9x3 – x2 + 3
f(x) = 12x5 – 8x4 + 36x3 – 4x2 + 48

Answers

Option A, The option that has the same potential roots according to the rational root theorem is 3x5 – 2x4 – 9x3 + x2 – 12.

How to solve for the roots

We have p, this is the factors of the number 12.

The factors are ±(1, 2, 3, 4, 6, 12)

We have factors of q = 3

= ±(1, 3)

The rational roots are the roots that have the same factors that are contained in the question.

Hence the answer is A.

Read more on Rational root theorem here:

https://brainly.com/question/2072459

#SPJ1

Answer:

The Answer is A

Step-by-step explanation:

Did it on edge :)

what is the measure of this

Answers

Answer:

60

Step-by-step explanation:

140-80=60

PLEASE HELP!!

From the triangle below, if AD=2 and CD=8. Find the Length of side AB

Answers

The result is D. You can find that triangle DBA and DCB are similar triangles. So DC/DB = DB/AD. DB=4 then AB can be figured out.

Write each equation in Slope-Intercept Form, if possible. Identify the slope and
y-intercept if they exist. Can you leave a detailed explanation please. Thank you
6x − 4y = 24

Answers

Answer:

slope intercept form: y = mx + b

6x - 4y = 24

4y = 6x - 24

y = 3/2x - 6

slope: 3/2

y intercept: - 6

Answer:

y = 3/2 x -6

The slope is 3/2 and the y intercept is -6

Step-by-step explanation:

6x-4y = 24

The slope intercept form is

y = mx+b  where m is the slope and b is the y intercept

We need to solve the equation for y

6x-4y =24

Subtract 6x from each side

6x-4y-6x =-6x+24

-4y = -6x+24

Divide each side by -4

-4y/-4 = -6x/-4  + 24/-4

y = 3/2 x -6

The slope is 3/2 and the y intercept is -6

Luther High School's basketball coach won a record 33 out of 42 games how many games must the team win in the next 28 games for the coach to maintain to the ratio of wins to losses?

Answers

Using proportions, they must win 22 games to maintain to the ratio of wins to losses.

What is a proportion?

A proportion is a fraction of a total amount, and the measures are related using a rule of three.

Considering the next 28 games, we have that:

The team will have won 33 + x games.The team will have played 42 + 28 = 70 games.

To keep the same proportion, we have that:

[tex]\frac{33}{42} = \frac{33 + x}{70}[/tex]

Applying cross multiplication:

42(33 + x) = 33 x 70

Simplifying by 14:

3(33 + x) = 33 x 5

3x = 33 x 5 - 33 x 3

3x = 33 x 2

3x = 66

x = 66/3

x = 22.

They must win 22 games to maintain to the ratio of wins to losses.

More can be learned about proportions at https://brainly.com/question/24372153

#SPJ1

The functions f(x) and g(x) are described using the following equation and table: f(x) = −6(1.05)x x g(x) −4 −9 −2 −6 0 −3 2 2 Which equation best compares the y-intercepts of f(x) and g(x)? The y-intercept of f(x) is equal to the y-intercept of g(x). The y-intercept of f(x) is equal to 2 times the y-intercept of g(x). The y-intercept of g(x) is equal to 2 times the y-intercept of f(x). The y-intercept of g(x) is equal to 2 plus the y-intercept of f(x). Question 12(Multiple Choice Worth 1 points) (01.04 MC) A store manager can spend at most $1,000 a day for operating costs and payroll. It costs $100 each day to operate the store and $30 dollars a day for each employee. Use the following inequality to determine how many employees the manager can afford for the day, at most: 30x + 100 ≤ 1000 x ≥ 30 x ≥ 33 x ≤ 33 x ≤ 30 Question 13(Multiple Choice Worth 1 points) (02.01 LC) Which of the following tables represents a function? x 1 −1 4 −4 y 8 8 10 10 x 2 2 3 3 y 6 −6 7 7 x 5 −5 5 −5 y 10 11 12 13 x 2 2 7 7 y 2 3 4 5 Question 14(Multiple Choice Worth 1 points) (01.06 LC) Joy needs 8 feet of fabric for a project she is working on, but the store only sells the fabric in meters. One meter of fabric costs $1.15. How much will the fabric cost? [1 ft = 0.305m] $9.20 $2.12 $2.81 $30.16 Question 15(Multiple Choice Worth 1 points) (04.02 LC) What is the solution to the following system of equations? x − 3y = 5 2x + y = 10 (5, 0) (0, 5) (7, 0) (0, 7) You must check the box below prior to submitting your exam! Check this box to indicate you are ready to submit your exam Instructors monitor ALL areas of a student's account Student e-mail accounts are to be used for FLVS course-related email only and not for general introductions or spamming of people in your address book. Please remember to click the Logoff link when you have completed your work in the course. FDK191.12

Answers

Based on our examination of the y-intercepts, we can deduce that the y-intercept of function f(x) is equivalent to two times the y-intercept of function g. (x)

What is the examination of the y-intercept?

The value of the function at the point where the value of x is equal to zero is known as the y-intercept.

f(x)=-6(1.05)^x

Considering x

x=0

f(0)=-6(1.05)^0

f(0)=-6(1)

f(0)=-6

Therefore, the y-intercept is point (0,-6)

Generally, the equation for the function of the y-intercept of g(x) is  mathematically given as

From table

at x=0

The y-intercept is the point (0,-3)

Based on our examination of the y-intercepts, we can deduce that the ty-intercept of function f(x) is equivalent to two times the y-intercept of function g. (x)

Read more about intercepts

https://brainly.com/question/14180189

#SPJ1

Which equation could possibly represent the graphed function?

Answers

Answer: A

Step-by-step explanation:

The polynomial has roots at [tex]x=-4, -2, 4[/tex].

So, the equation should have factors of [tex](x+4), (x-2), (x-4)[/tex].

This eliminates everything except for A.

In the triangle below M, Z, and P are the midpoints of the sides. Name a segment that is parallel to the one given. Pay attention to the order of the points used in the given side.

Answers

Based on the triangle midsegment theorem, the midsegments and the sides they are parallel to are:

MP is parallel to XY

PZ is parallel to WX

MZ is parallel to WY

What is the Triangle Midsegment Theorem?

The segment that connects the midpoints of two sides of a triangle is referred to as the midsegment of the triangle. All triangles possess three midsegments. According to the triangle midsegment theorem, the third side of the triangle that is directly opposite the midsegment is twice the size of the midsegment and it is parallel to it.

In the diagram showing triangle WXY with midpoints at points M, Z, and P, the midsegments are:

MP which is parallel to XY, also, MP = 1/2(XY)

PZ which is parallel to WX, also, PZ = 1/2(WX)

MZ which is parallel to WY. also, MZ = 1/2(WY)

Thus, the midsegments and the sides they are parallel to are:

MP is parallel to XY

PZ is parallel to WX

MZ is parallel to WY

Learn more about triangle midsegment theorem on:

https://brainly.com/question/12234706

#SPJ1

What is the product?
2
12 64
78 30
6
32
78 30
(050
69
78 30
899
32
39 15
66 8
64
38 30

Answers

Answer:

the product is 1.32057606543E32

Question 9(Multiple Choice Worth 5 points)
(04.06A LC)
What is the slope of the line segment?
15
12
9
6
63
0123
0-3
0-13/1
O
O
1/3
3
5

Answers

Answer: 3

Step-by-step explanation:

[tex]\frac{3-0}{1-0}=3[/tex]

On a recent trip to the convenience store, you picked up 2 gallons of milk, 6 bottles of water, and 7 snack-size bags of chips. Your total bill (before tax) was $25.65. If a bottle of water costs twice as much as a bag of chips, and a gallon of milk costs $1.90 more than a bottle of water, how much does each item cost?

Answers

Answer:

The water costs $1.90, the chips are $.95 and the milk is $3.80.

Step-by-step explanation:

Let m = milk

Let w = water

Let c = chips

2m+6w+7c =25.65      w = 2c     m = w + 1.90

For the first equation, substitute w for 2C and m for w + 1.90 to get:

2(w+1.90) +6(2c) + 7c = 25.65

2w+3.8+12c+7c=25.65

2w+19c = 21.85

Now substitute 2c for w:

2(2c)+19c =21.85

4c + 19c = 21.85

23c = 21.85

c = .95  Now that we know the cost of the chips we can use that to find the water and the milk for the original equations that we wrote at the top.

w = 2c

w=2(.95) = 1.90

m = w + 1.90 = 1.90+1.90 = 3.80

Express the formula in terms of the height, Use that formula to find the height when the volume is and the radius is

Answers

The formula to find the height of the Cylinder is; h = V/(πr²) and at V = 45π and r = 3, we have; h = 5

How to change the subject of the formula?

We are given the formula for volume of a cylinder as;

V = πr²h

where;

h is height

r is radius

To make h the subject, let us divide both sides by  πr² to get;

V/(πr²) = h

At V = 45π and r = 3, we have;

h = 45π/(πr²)

h = 45/3²

h = 5

Read more about Subject of formula at; https://brainly.com/question/10643782

#SPJ1

This is worth 33 POInTS PLEASE HELP

Answers

The maximum amount of water that can be used by each house on a daily basis is 100 liters.

Equation

Common utilities in the community = 500 litersNumber of houses = 40 housesCapacity of water tank = 4,500 litersWater used per house = x

4,500 = 500 + 40x

4,500 - 500 = 40x

4,000 = 40x

x = 4,000 / 40

x = 100 liters

Learn more about equation:

https://brainly.com/question/2972832

#SPJ1

The radioactive element​ carbon-14 has a​ half-life of 5750 years. A scientist determined that the bones from a mastodon had lost 57.5​% of their​ carbon-14. How old were the bones at the time they were​ discovered?

Answers

Therefore, the bones were 6612.5 years old at the time they were discovered.

Half life

Given that the radioactive element​ carbon-14 has a​ half-life of 5750 years, and a scientist determined that the bones from a mastodon had lost 57.5​% of their​ carbon-14, to determine how old were the bones at the time they were discovered, the following calculation must be made:

50 = 5750100 = 1150057.5 = X57.5 x 11500 / 100 = X6612.5 = X

Therefore, the bones were 6612.5 years old at the time they were discovered.

Learn more about half life in https://brainly.com/question/24710827

#SPJ1

Answer:Therefore, the bones were 6612.5 years old at the time they were discovered.

Step-by-step explanation:

A number is negative if and only if it is less than 0.
p. A number is negative.
q. A number is less than 0.
Which represents the inverse of this statement? Is the inverse true or false?
~p4~9
The inverse of the statement is sometimes true and sometimes false.
Oq+p
The inverse of the statement is true.
q→P
~q→ ~p
The inverse of the statement is false.

Answers

The inverse statement is:

¬q ⇒ ¬p

Which is true.

How to get the inverse statement?

Here we have the biconditional statement:

A number is negative if and only if it is less than zero.

Where:

p = a number is negative.q = a number is less than 0.

So we can write the statement as:

p ⇔ q

The inverse statement is:

if not q, then not p.

or

¬q ⇒ ¬p

Replacing p and q, we have:

"if a number is not less than zero, then the number is not negative".

This is true, if the number is not less than zero, then the number is 0 or larger, so that number is not negative.

If you want to learn more about conditonal statements:

https://brainly.com/question/11073037

#SPJ1

Answer:

D.

∼p↔∼q

and

G.

The inverse of the statement is true.

Step-by-step explanation:

I need help with my work

Answers

(In c) * 1/c = 0.0604 is the change in the function.

According to the statement

y = (In x)^2 on interval [1,4]

By mean value theorem

we use this formula to find a change f '(c)= [f(b) - f(a)] / (b - a)

Let it f(y) = (In x)^2

Now, f(4) = (In 4)^2

f(4) = (0.602)^2

f(4) = 0.3624

and

f(1) = (In 1)^2

f(1) = (0)^2

f(1) = 0

Now, f'(c) = 2 (In c) * 1/c

Substitute all these values in a formula

2 (In c) * 1/c = 0.3624 - 0 / 4 - 1

2 (In c) * 1/c = 0.3624/3

2 (In c) * 1/c = 0.1208

(In c) * 1/c = 0.0604

So, (In c) * 1/c = 0.0604 is the change in the function.

Learn more about FUNCTION here  https://brainly.com/question/2456547

#SPJ1

Question 7 (1 point) The two tables below show the amount of tip, y, included on a bill charging x dollars. A 2-column table with 3 rows titled Restaurant A. Column 1 is labeled x with entries 10, 20, 30. Column 2 is labeled y with entries 1, 2, 3. A 2-column table with 3 rows titled Restaurant B. Column 1 is labeled x with entries 25, 50, 75. Column 2 is labeled y with entries 5, 10, 15. Which compares the slopes of the lines created by the tables?

Answers

The slope of restaurant B is twice that of restaurant A

How to compare the slopes?

The tables of values are given as

           X(Bill)     Y(Tip)                          X(Bill)        Y(Tip)

Rest A     10           1                  Rest B      25            5    

Rest A     20          2                 Rest B      50            10

Rest A     30          3                 Rest B      75             15

The slopes are calculated using

Slope = (y2 - y1)/(x2 - x1)

Using the table of values, we have:

Rest A = (2 - 1)/(20 - 10)

Rest A = 0.1

Rest B = (10 - 5)/(50 - 25)

Rest B = 0.2

By comparing the slopes, we have:

Rest B = 2 * Rest A

This implies that the slope of restaurant B is twice that of restaurant A

Read more about slopes at:

https://brainly.com/question/3493733

#SPJ1

Write the recursive rule for the 5th term of the sequence: -7, -3, 1, 5, 9

Answers

Answer:

Step-by-step explanation:

Let  [tex]x_{n}[/tex] represent the nth term in the sequence. Then  [tex]x_{n-1}[/tex] represents the previous term

The first term, [tex]x_{1}[/tex] = -7

Each consecutive term is obtained by adding 4 to the previous term.

So the recursive relation is
[tex]\left \{ {{x_{1}= -7} \atop {x_{n}= x_{n-1} + 4}} \right.[/tex]

I need some help please

Answers

The values of x and y that can represent the equation is illustrated.

How to illustrate the information?

The equation given us 32 = xy + 16

The table will be:

x. y

4. 4

16. 1

2. 8

32. 0.5

For example, when x and y are 4. This will be:

= xy + 16

= (4 × 4) + 16

= 32

Other values of x and y will also give 32.

Learn more about equations on:

brainly.com/question/2972832

#SPJ1

which quantity is scalary

Answers

Step-by-step explanation:

find the greatest number which divides 225 and 1029 leaving remainder of 5 in each case

Simplify
18÷[7+2{7+2(7-6)}+2
Answer is
[tex] \frac{2}{3} [/tex]
Show me the steps by steps​

Answers

Answer:

[tex] \frac{2}{3} [/tex]

Step-by-step explanation:

=18÷[7+2{7+2(7-6)}+2]

=18÷[7+2{7+2×1}+2]

=18÷[7+2×9+2]

=18÷[7+18+2]

=18÷27

=[tex] \frac{18}{27} [/tex]

=9 two is 18 and 9 three is 27

So,

=[tex] \frac{2}{3} [/tex]

Tell whether the equation 3x - 6y = 0 is a direct variation. Explain. If the equation is a direct variation, identify the constant of variation.

Answers

The equation is in direct variation and have constant of variation is 2.

According to the statement

we have given equation is 3x - 6y = 0 and find that the equation is direct variation of not.

Direct variation is the mathematical relationship between two variables that can be expressed by an equation in which one variable is equal to a constant times the other.

So, to find the direct variation equate the given equation equal to zero and solve it.

So, 3x - 6y = 0

3x=6y

or

x/ y=2 or x=2⋅y

here x is directly proportional to the y by 2 times.

∴x∝y

So, this equation in direct variations and constant of variation is 2.

From above this is clear that the equation is in direct variation and have constant of variation is 2.

Learn more about the Equation here https://brainly.com/question/2972832

#SPJ1

DATE PAGE No. Demand 10 a) A ratio of two number is equal to 3:8. If the smaller number is 12, find the greater number:​

Answers

From ratio concept, the greater number number is 32 .

What is the greater number from concept of ratio ?

A ratio exists as an ordered pair of numbers a and b, written a / b where b does not equivalent to 0. A proportion exists in an equation in which two ratios stand set equal to each other. For example, if there exists 1 boy and 3 girls you could write the ratio as 1 : 3 (for every one boy there exist 3 girls)

Let the greater number be x .

The ratio given is 3:8 .

Thus, by the concept of ratio -

⇒ 3/8 = 12/x

⇒ x = (8/3 * 12)

∴  x = 32

Therefore, from ratio concept, the greater number number is 32 .

To learn more about concept of ratio, refer -

https://brainly.com/question/130130

#SPJ9

Elena cuts out a rectangle that has a perimeter of 156 inches and a length of 56 inches. She cuts out another rectangle that is the same length and twice as wide. What is the perimeter of the new ractangle?

Answers

answer: 200, 2 hundred, two hundred

solve for x the triangles are similar

Answers

Answer:

x = 10

Step-by-step explanation:

∆RSE ~ ∆FGE

SE/ GE = RE/ FE

45/ 12x-3 = 55/ 143

3/ 3(4x - 1) = 11/ 143

11(4x-1) = 429

44x-11 = 429

44x = 440

x =10

The length of two sides of the right triangle ABC shown in the illustration are given. Find the length of the third side in centimeters. a=12cm and c=37cm

Answers

By using Pythagoran theorem, the length of the third side of the triangle ABC is 35 centimeters.

How to find the missing side of a right triangle

In this question we know the lengths of two sides of the right triangle. By Pythagorean theorem we get the length of the missing side:

a² + b² = c²

b² = c² - a²

b = √(c² - a²)

b = √(37² - 12²)

b = 35

By using Pythagoran theorem, the length of the third side of the triangle ABC is 35 centimeters.

To learn more on Pythagorean theorem: https://brainly.com/question/26183488

#SPJ1

Other Questions
A study of blood pressure and age compares the blood pressures of men in three age groups: less than 30 years, 30 to 55 years, and over 55 years. Select the best method to analyze the data. a. Wilcoxon rank sum test b. Mann-Whitney test c. Kruskal-Wallis test d. Wilcoxon signed rank test Suppose that you borrow $10,000 on a 60-month car loan at 6.25% APR. Compute the monthly payment. a. Set up an equation for the problem using the following variables: n i pv pmt fv; where n=number of periods and i= interest rate per periodWhat is the actual formula?Does this one work? Part of a homeowner's insurance policy covers one miscellaneous loss per year, which is known to have a 10% chance of occurring. If there is a miscellaneous loss, the probability is c/x that the loss amount is $100x, for x = 1, 2, ...,5, where c is a constant. These are the only loss amounts possible. If the deductible for a miscellaneous loss is $200, determine the net premium for this part of the policythat is, the amount that the insurance company must charge to break even. if the enzyme-catalyzed reaction e s es e p is proceeding at or near the vmax of e, what can be deduced about the relative concentrations of s and es What is the floor of the House and Senate chambers?1. the place in each chamber where members of Congress vote on whether bills should be laws2. the place in each chamber where members of Congress stand to talk to constituents3. the place in each chamber where members of Congress give speeches about bills4. the place in each chamber where members of Congress investigate the possible effects of a bill Minerals can be classified based on cleavage or fracture. These two properties refer to the way in which a mineral tends to break. Cleavage is an orderly breakage in well-defined planes. It means that the broken piece of mineral will have flat and smooth sides. Fracture is a random breakage. If a mineral breaks with rough, random, uneven surfaces, it is said to have fractured. Because each of your mineral samples have already been broken from another, larger piece of a mineral, you should be able to tell if it has cleavage or fractures by looking at its sides. Of your 10 minerals, identify three that experienced cleavage. a cube-shaped gray mineral with smooth faces and sharp edges,a rust-colored mineral with a rough, uneven surface In "Bowling Alone," Robert Putnam discusses the reduced amount of social activity and civic engagement among U.S. adults during the past 40 years. Democratic governance, some have argued, depends to some degree on civic engagement and the social capital that it engenders. Putnam advances a number of reasons for the decline in civic engagement or the increase in "Bowling Alone." A leading hypothesis is that television viewing a solitary activity has replaced social activity as a primary form of leisure activity. The article was written a while ago. Today, he might extend that hypothesis to include the extent to which social media replaces conversation and social activity. Building on this information, please answer the following questions.1. What is the dependent variable in the hypothesis regarding television viewing?2. What is the independent variable in the hypothesis regarding social media?3. What is the hypothesized direction of the association between the independent and dependent variable in the social media hypothesispositive, negative, null, or the direction of association cannot be determined?4. In a sentence or two, please explain your reasoning for your answer in c.5. What is the null hypothesis for the hypothesis regarding TV viewing and civic engagement? the sequence of part of an mrna transcript is 5augcccaacagcaagaguggugcccugucgaaggag3 what is the sequence of the dna coding strand? how are the shapes alikei need to know When performing a nutrition assessment, the practitioner should include what information as part of the patient's food and nutrition history? Using the article "You Trouble" discuss whether or not stunt videos cause teens to take risks and increase impulsive behavior consider the given state of stress. take a = 21 mpa and b = 45 mpa. determine the principal planes. the principal planes are at and .Determine the principal planes using Mohr's circle. a) The principal planes are at and .Determine the principal stresses using Mohr's circle. b)The minimum principal stress is MPa, and the maximum principal stress is MPa.Determine the orientation of the planes of maximum in-plane shearing stress using Mohr's circle. c) The orientation of the plane of maximum in-plane shearing stress in the first quadrant is . The orientation of the plane of maximum in-plane shearing stress in the second quadrant is .Determine the maximum in-plane shearing stress using Mohr's circle. d) The maximum in-plane shearing stress is MPa.Determine the normal stress using Mohr's circle. e)The normal stress is MPa. What are the three key components of the production process? machines, equipment, and tools purchasing, sales, and distribution testing, quality assurance, and compliancematerials, machines, and people let a2 = a. prove that either a is singular or det(a) = 1 relative to the current dsm-iv system of classifying mental disorders, the five-factor model suggests question Q#6 If a roan bull is crossed with a white cow, what percent of offspring will have a roan phenotype? 100% 753 25 SON Question 7 Q#7 Both Mrs. Smith and Mrs Jones had baby girls the same day in the same hospital. Mrs. Smith took home a baby girl, who she ca Shirley. Mrs. Jones took home a baby girl named Jane. Mrs. Jones began to suspect however, that her child and the Smith baby had accidentally switched in the nursery. Blood tests were made. Mr. Smith is Type A Mes Smith is Type B. Mr. Jones is Type A Mestone Type A. Shirley is Type O, and Jane is Type B. Had a mix-up occurred, or is it impossible to tell with the given information it is impossible to tell with the oven Information Alkup occured. The Smiths could not have had a bay with type o blood Amb up occured. The Jones could not have had a baby with Type B blood Amik up occured. Neither parents could have produced a baby with the stated blood type Question 8 Gomovies.com Q8 If a man of genotype i marries a woman of genotype what possible blood types could their children have their children could have A Bor AB blood types their children could have A st As blood types their children could have A B. ABor blood types the children could have A or blood tyres Search O 31 Question 2 of 10Which question would be most appropriate to ask yourself when consideringhow to address your audience for a procedural document?OA. What research do I need to do to understand my topic?B. Will readers respond best to a formal or informal style?OC. Why can't I find a good image to illustrate my points?OD. Where can I go for information about my topic?WSUBMIT if you are asked to speak for 10 minutes at a luncheon meeting, it is appropriate for you to go 5 or 10 minutes beyond this.t/F For each question, you will want to answer the following:What type of analysis should be used to answer this question? Why?You should run the proper analysis and then interpret the answer.********If the restaurant is planning to have a waterfront view, should they plan to build segments around marital status?If the restaurant is planning to target a more affluent audience, what should they consider with elegant vs. simple decor options?Should the restaurant choose a jazz combo or a string quartet?What is the average family size of the population under study? Put an X next to all the statements that can be considered signs of global warming.A. The concentration of CO2 is at 400 parts per million (ppm) today. It has never been more than 300 ppm in the past 800,000 years.B. Global sea level rose about 6.7 in. in the past century. The rate in the past decade, however, is nearly double that of the past century.C. Since 1880, the 10 hottest years on record have been in the past 17 years.D. Antarctica lost about 36 cubic miles of ice between 2002 and 2005.E. Since the beginning of the Industrial Revolution in the 1880s, the acidity of surface ocean waters has increased by about 30 percent.F. The area covered by sea ice in the Arctic at the end of summer has shrunk by about 40% since 1979.G. Currently, 37 glaciers in Glacier National Park are retreating.H. Since 1990, data show that birds are beginning their northern migration earlier and earlier each yearparticularly birds that migrate over shorter distances. They are having trouble finding their normal food sources at their destination.I. The amount of heavy downpours has increased 74% in New England from 1958to 2011.